Skip to main content

Full text of "Major antigenic protein 2 of Cowdria ruminantium : potential value for serological diagnosis"

See other formats


MAJOR ANTIGENIC PROTEIN 2 OF COWDRIA RUMINANTIUM: 
POTENTIAL VALUE FOR SEROLOGICAL DIAGNOSIS 



By 
MICHAEL V. BOWIE 



A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL 

OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT 

OF THE REQUIREMENTS FOR THE DEGREE OF 

DOCTOR OF PHILOSOPHY 

UNIVERSITY OF FLORIDA 

1997 






IN MEMORY OF 

Lewis R. Harris, Sr. (great-grandfather) 

Sidney Butler (uncle) 

R. Andy Norval (mentor and friend) 

Ronald Thornhill (brother in Omega) 

Andre Jervis (brother in Omega) 

Darrell Turner (roommate/brother in Omega) 

Robert Johnson (roommate/friend) 

MEN WHO HAVE GIVEN ME LIFE'S GREATEST GIFT 
"FRIENDSHIP" 



First and foremost, 
Thank you Lord for all that You have given me, no one could ask for more. 

To my mom, sister Karen, and brother Gerald. 

Times have been hard and you stood by me. 

Thanks for your support and love. 

To my DAD Jay, 

Continue to be an example for all men. 

I am just as proud of you as you are of me. 

Thanks for being a part of my life. 

I love you. 

To my fraternity brothers, who gave day to day guidance. 
You knew when I needed it. 
"Friendship Is Essential to the Soul" 

To my many friends 
"Thanks" 



'Life for me ain't been no crystal staircase"- Langston Hughes 






ACKNOWLEDGMENTS 

I would like to express my gratitude to my advisor and committee chairman Dr. 
Anthony Barbet, who gave many valuable suggestions throughout this work. His time and 
commitment will always be appreciated. I would also like to thank my committee cochairman 
Dr. Roman R. Ganta for his many recommendations, especially as they relate to obtaining 
fragments of the gene for the MAP2 homologs of the Ehrlichia species during Dr. Barbet's 
sabbatical leave. 

I would like to acknowledge all my committee members for their assistance during my 
pursuit of this degree: Dr. Donald Forrester for his counseling, consultation, and expertise on 
wildlife diseases; Dr. Mary Brown for assisting with the ELISA studies and providing 
encouragement; Dr. Ramon Littell for his statistical guidance; and Dr. Kathy Kocan for her 
heartwater background and participation on my committee (she has help fill a void in my 
program). 

I am greatly appreciative to Dr. Suman Mahan and the Veterinary Research 
Laboratory staff in Causeway (Zimbabwe) for providing blood samples and the immunoblot 
data and for performing the peptide studies. I would like to acknowledge Dr. Michael 
Burridge for continuously supporting my project, both mentally and financially; Dr. David 
Alfred for his advice; Dr. Jacqueline Dawson for the genomic DNA of Ehrlichia chaffeensis 



in 



and Ehrlichia canis; and Dr. Emmanuel Camus for help offered during my collection of ticks 
from Guadeloupe. I would also like to recognize Linda Greene, Scherwin Henry, and Lucia 
Dinehart of Hybridoma Laboratory for their assistance in the isolation of monoclonal 
antibodies. 

I am especially grateful to Anna Lundgren, Rene Blentlinger, Paul Meade, Sondra 
Kamper, John Thobourn, and Bill Whitmire of the Barbet Laboratory for providing assistance; 
Dr. Trevor Peter, Dr. Sharon Deem, Dr. Marty Ewing, Dr. Susan Oberle, Dr. Nareerat "Pop" 
Vishenakul, Dr. Jennifer Calder, Mr. Bigboy Simbi, Dr. Rick Alleman, Dr. Teresa Martinez, 
Mrs. Roberta O'Connor, Ms. Kelly Watts, and Mr. Aceme Nyika (past and present graduate 
students) for their friendship, ideas, and valuable help; and the Office and Research staff of 
the Department of Pathobiology, the Ticks and Tick-borne Diseases Program, and the 
Graduate Research Office, especially Tonya Gibbs, Eunice Mobley, Carlos Sulsona, Suzanne 
Stroup, Sharon Kitchen, and Sally O'Connell, for offering their expertise in their various 
areas. 

Finally, I am greatly indebted to Annie Moreland, for her assistance and suggestions 
during my studies, as well as, for her friendship, and Debbie Couch for her guidance and 
support during my stay at the University of Florida. 



IV 



TABLE OF CONTENTS 

ACKNOWLEDGMENTS iii 

LIST OF TABLES viii 

LIST OF FIGURES x 

ABBREVIATIONS xii 

ABSTRACT xiii 

CHAPTERS 

1 INTRODUCTION 1 

Background 3 

Justification 7 

Research Objectives 7 

2 LITERATURE REVIEW 9 

Epizootiology 9 

Biology and Distribution of the Vector 9 

Parasite-Host Interactions 12 

Vector-Parasite Interactions 14 

Host- Vector Interactions 15 

Control of Heartwater 17 

Clinical Manifestations 17 

Therapy 19 

Vector Control 20 

Vaccines 20 

Enzootic Stability 23 

Diagnosis of Cowdria ruminantium 23 

The Research Problem 29 

3 ANALYSIS OF THE MAJOR ANTIGENIC PROTEIN 2 GENES 
FROM FIVE GEOGRAPHIC ISOLATES OF COWDRIA 

RUMINANTIUM 31 

Introduction 31 



Materials and Methods 35 

Origin of Cowdria ruminantium Isolates 35 

Amplification of the mapl Gene of Different Geographic 

Isolates 35 

Cloning and Restriction Enzyme Analysis 36 

DNA Sequencing and Sequence Data Analysis 37 

Southern Blot Analysis 39 

Results 44 

Cloning and Restriction Enzyme Analysis of the MAP2 

Genes 44 

Sequence Analysis of MAP2 Genes 46 

Discussion 57 

IMMUNOASSAYS USING MAP2 TO IDENTIFY ANTl-COWDRIA 
RUMINANTIUM ANTIBODIES IN THE SERA OF INFECTED 

ANIMALS 61 

Introduction 61 

Materials and Methods 64 

Cowdria ruminantium recombinant MAP2 Production 

and Purification 64 

Antisera 65 

MAP2 Coating Concentration 65 

Indirect ELISA 66 

Immunization of Mice 67 

Screening for Monoclonal Antibodies 67 

Competitive ELISA Development 68 

Percent Inhibition 68 

Results 71 

Isolation and Characterization of Recombinant MAP2 71 

Indirect ELISA for Heartwater Diagnosis Using MAP2 71 

Responses by Immunized Mice 71 

Competitive Inhibition ELISA for Heartwater Diagnosis 

Using MAP2 72 

Discussion 80 

ANALYSIS OF MAP2 HOMOLOGS OF EHRLICHIA CHAFFEENSIS 

AND EHRLICHIA CANIS 82 

Introduction 82 

Materials and Methods 85 

Immunoblot of C. ruminantium and Ehrlichia canis Antigens . . 85 

Origin of Ehrlichia canis and Ehrlichia chaffeensis 85 

Amplification of the MAP2 Homologs Genes of Ehrlichia canis 
and Ehrlichia chaffeensis 86 



VI 



Cloning 87 

DNA Sequencing and Sequence Data Analysis 87 

Southern Blot Analysis 89 

Results 95 

Immunoblot Demonstrating Antigenic Similarity between 

Cowdria ruminantium and Ehrlichia canis 95 

Cloning and Sequence Analysis of the MAP2 Homologs of 

Ehrlichia chaffeensis and Ehrlichia canis 95 

Sequence Analysis of the MAP2 Analogs 97 

Discussion 112 

6 CONCLUSIONS AND RECOMMENDATIONS 119 

LIST OF REFERENCES 124 

BIOGRAPHICAL SKETCH 142 



vn 



LIST OF TABLES 

Table Page 

1. Primers Designed Based on the Reported Sequence of pF5.2 41 

2. Primer Combinations and Projected Product Size 43 

3. Comparison of the MAP2 Coding Sequences at the Nucleotide Level 52 

4. MAP2 Amino Acid Sequence Changes Between Different Isolates of 
Cowdria ruminantium 54 

5. Percent Identity Between the MAP2 Coding Sequences of Cowdria 
ruminantium Isolates 55 

6. Percent Identity Between MAP2 Amino Acid Sequences of Cowdria 
ruminantium Isolates 56 

7. Prediction of Antigenic Determinants of C. ruminantium Isolates 59 

8. Position and Sequence of Flexible Segments 60 

9. Ovine and Bovine Sera Tested 69 

10. Primers Designed or Selected for Amplification of the Genes Encoding 

the MAP2 Homo logs of Ehrlichia canis and Ehrlichia chaff eensis 91 

1 1 . Primer Combinations and Optimal Temperatures for Amplification of the 
Genes Encoding the MAP2 Homo logs of Ehrlichia canis and Ehrlichia 
chaffeensis 94 

12. Percent Identity of Nucleic Acid Sequences of MAP2 Homologs of 
Cowdria ruminantium, Ehrlichia canis, and Ehrlichia chaffeensis 110 

13. Percent (%) Identity of Amino Acid Sequences of MAP2 Homologs of 
Cowdria ruminantium, Ehrlichia canis and Ehrlichia chaffeensis Ill 



vin 



Table Page 

14. Percent (%) Identity ofmap2 Nucleic Acid Sequences/ 16S rDNA 
Sequences 117 

15. Prediction of Antigenic Determinants 118 






IX 



LIST OF FIGURES 

Figure Page 

1. DNA Sequence of pF5.2 Plasmid Insert DNA 42 

2. Analysis of PCR Products of the Highway Isolate of Cowdria ruminantium 
Using Various Primer Combinations 46 

3. Analysis of PCR Products of the Five Isolates of Cowdria ruminantium 
Using Primers AB249 and AB251 47 

4. Southern Blot Analysis of PCR Products of the Five Isolates of 

Cowdria ruminantium Using Primers AB249 and AB25 1 48 

5. Restriction Maps of the map! Genes from Cowdria ruminantium Isolates . 49 

6. Comparison of the MAP2 Coding Sequences at the Nucleotide Level 50 

7. Comparison of the MAP2 Coding Sequences at the Amino Acid Level .... 53 

8. Major Antigenic Protein 2 73 

9. Titration of MAP2 Antigen 74 

10. Indirect ELISA Using Sheep Serum 75 

1 1 . Mouse Anti-MAP2 Antiserum Titer 76 

12. 1D5 Hybridoma Supernatant Versus Sheep Sera (1:50) 77 

13. 4D5 Hybridoma Supernatant Versus Sheep Sera (1 :50) 78 

14. Monoclonal Antibodies Versus Sheep Sera 79 

15. Gap Program Using the Major Surface Protein 5 ofAnaplasma 

marginale versus MAP2 of Cowdria ruminantium 92 



16. Immunoblot Demonstrating Antigenic Similarity Between Cowdria 
ruminantium and Ehrlichia canis 99 

1 7. Analysis of PCR Products of Ehrlichia canis Using Primer 
AB282/AB284 100 

1 8. Analysis of PCR Products of Ehrlichia chaffeensis Using Primer 
AB282/AB284 101 

19. Analysis of PCR Products of Ehrlichia canis and Ehrlichia chaffeensis 
Using Various Primer Combinations 1 02 

20. Southern Blot Analysis of PCR Products of Ehrlichia canis and Ehrlichia 
chaffeensis Using Various Primer Combinations 1 03 

2 1 . Analysis of PCR Products of Ehrlichia canis and Ehrlichia chaffeensis 
Using Various Combinations 1 04 

22. Complete Sequence of the MAP2 Homolog of Ehrlichia canis 105 

23. Complete Sequence of the MAP2 Homolog of Ehrlichia chaffeensis .... 106 

24. Comparison of the Coding Nucleotide Sequences of MAP2 and MAP2 
Homo logs of Isolates of Cowdria ruminantium and Ehrlichia Species ... 107 

25. Comparison of the MAP2 and MAP2-like Coding Sequences at the 

Amino Acid Level 1 09 

26. DNA Sequence of pF5.2 Plasmid Insert DNA 116 



XI 



ABBREVIATIONS 






BAE bovine aortic endothelial 

cELISA competitive enzyme-linked immunosorbent assay 

DNA deoxyribonucleic acid 

dATP deoxyadenosine triphosphate 

dCTP deoxycytidine triphosphate 

dGTP deoxyguanosine triphosphate 

dNTP deoxynucleotide 

dTTP deoxythymidine triphosphate 

DTT dithiothreitol 

EDTA ethylenediaminetetraacetic acid 

ELISA enzyme-linked immunosorbent assay 

EMVT Institute d'Elevage et de Medecine Veterinaire des Pays Tropicale 

GCG Genetics Computer Group 

ICBR Interdisciplinary Center for Biotechnology Research 

IFA indirect fluorescent antibody assay 

IPTG Isopropyl-P-D-thiogalactopyranoside 

kDa kilodalton 

M molar 

MAb monoclonal antibodies 

MAP major antigenic protein 

map gene encoding major antigenic protein 

ml milliliter 

mM millimolar 

MSP major surface protein 

msp gene encoding major surface protein 

N Normal 

PCR polymerase chain reaction 

rMAP2 recombinant major antigenic protein 2 

SADC Southern African Development Community 

SDS sodium dodecyl sulfate 

USAID United States Agency for International Development 

USDA United States Department of Agriculture 

USFWS United States Fish and Wildlife Service 

UTP uridine triphosphate 

ul microliter 

uM micromolar 



xn 



"" 



Abstract of Dissertation Presented to the Graduate School 
of the University of Florida in Partial Fulfillment of the 
Requirements for the Degree of Doctor of Philosophy 

A MAJOR ANTIGENIC PROTEIN 2 

OF COWDR1A RUMINANTIUM: POTENTIAL VALUE FOR 

SEROLOGICAL DIAGNOSIS 

By 

Michael V. Bowie 

December, 1997 

Chairman: Dr. Anthony F. Barbet 
Cochairman: Dr. G. Roman Reddy 
Major Department: Veterinary Medicine 

The overall objective of this dissertation was to determine the applicability of major 

antigenic protein 2 (MAP2) of Cowdria ruminantium for the diagnosis of heartwater. C. 

ruminantium is the etiologic agent of heartwater, a rickettsial disease that causes mortalities 

(up to 90%) in populations of susceptible ruminants in sub-Saharan Africa and in the 

Caribbean. In order to determine the heartwater status of animal populations, a rapid, 

sensitive, and specific diagnostic test must be developed. Two major antigenic proteins of 

C. ruminantium have been examined in heartwater diagnosis. The objectives of this 

dissertation were (1) to determine if MAP2 was conserved in five geographically different 

isolates of C. ruminantium, (2) to determine if MAP2 reacted with animal sera obtained from 

areas free of both the vector and the disease (false positive sera), and (3) to determine 



xm 



whether MAP2 homologs occur in Ehrlichia chaffeensis, the organism responsible for human 
monocytic ehrlichiosis, and E canis, a canine ehrlichiosis agent, both of which have been 
reported to be closely related to C. ruminantium by rRNA studies. 

The conservation of MAP2 among isolates of C. ruminantium would be essential for 
developing a specific diagnostic test for heartwater. Primers were developed based on the 
reported sequence of the Crystal Springs isolate of C ruminantium. Target DNA of five 
isolates of C ruminantium was amplified, cloned and sequenced. All map2 genes were 627 
bases and identical with the exception often nucleic acid substitutions between different 
isolates. These substitutions translated into only three amino acid changes indicating that 
MAP2 was conserved and may be a candidate for the development of serodiagnostic tests. 
Recombinant MAP2 was isolated and reacted in an indirect ELISA with sera from 
heartwater-infected sheep and with false positive sera. In addition, monoclonal antibodies 
(MAbs), which reacted in an indirect ELISA with MAP2, were tested in a competitive ELISA 
(cELISA). Positive, negative, and false positive sera were used as the competing antibody 
against the MAbs. Both positive and false positive sera inhibited binding of all MAbs, 
therefore recombinant MAP2 was not useful in a cELISA using these four MAbs due to 
cross-reactivity. 

A homolog to MAP2 has been reported in Anaplasma marginale (major surface 
protein 5; MSP5) which has been used for serodiagnosis of bovine anaplasmosis. In addition, 
antisera against Ehrlichia canis, causative agent of canine ehrlichiosis, recognized MAP2 in 
immunoblots suggesting the presence of a MAP2 homolog. Genes representing the MAP2 
homologs from E canis and E chaffeensis were amplified, cloned, and sequenced. MAP2 



xiv 



homologsofE chaffeensis and E. canis were 83.41% and 84.39% similar, respectively, with 
C. ruminantium at the amino acid level. The initiator methionine of the homologs of MAP2 
were four amino acids downstream from the reported start codon of MAP2 of C. 
ruminantium. Further examination oftheMAP2 homologs in C. ruminantium and Ehrlichiae 
allow for development of a specific test for serodiagnosis of heartwater. 



xv 






CHAPTER 1 
INTRODUCTION 



Cowdriosis is one of the most economically important tick-borne diseases affecting 
wild and domestic ruminants in Africa (Uilenberg, 1 983). This disease, transmitted by several 
ticks of the genus Amblyomma, is caused by the rickettsia Cowdria ruminantium (Cowdry, 
1925a; Cowdry, 1925b) and is commonly referred to as heartwater disease. In addition to 
sub-Saharan Africa and Africa's neighboring islands, heartwater has been identified on several 
Caribbean islands (Perreau et ah, 1980); thus, posing a threat of introduction into the 
Americas. 

Heartwater infection causes high mortality and morbidity in susceptible populations 
of cattle, sheep, and goats (Provost and Bezuidenhout, 1 987). Animals which recover from 
heartwater infection become asymptomatic carriers and may serve as reservoirs for the disease 
(Andrew and Norval, 1989). In order to determine populations of animals infected with C. 
ruminantium, a rapid, sensitive, and specific diagnostic test must be developed. 

Isolation of genes encoding immunoreactive proteins of C. ruminantium enabled 
development into recombinant forms that may be used as antigens in diagnostic tests and 
vaccines. However, the uniqueness of the protein must be determined since many rickettsia 
possess common, surface proteins that function in recognition, adherence, and invasion. In 
1 99 1 , a 32 kilodalton (kDa) protein, recently referred to as major antigenic protein 1 (MAP 1 ), 



2 
was isolated from C. ruminantium-mfected endothelial cell cultures and used in a competitive 
enzyme-linked immunosorbent assay (cELISA) (Jongejan and Thielemans, 1989; Jongejan 
et al., 1 99 1 ). However, MAP 1 reacted with sera from animals from a heartwater-free region 
of Zimbabwe in Western blots (Mahan et al., 1993). After several tests to determine whether 
these regions were truly free of the vector and the agent, it was found that a cross-reacting 
organism occurred in this region. Antibodies to this agent bound to MAPI of C. 
ruminantium and caused false positive reactions in various tests (e.g. indirect fluorescent 
antibody tests, ELISAs, direct fluorescent antibody tests, and complement fixation) that used 
either MAPI or whole organisms as antigen. The encoding gene of a second major antigenic 
protein with a molecular weight of 21 kDa, MAP2, was isolated, cloned and expressed in 
Escherichia coli (Mahan et al., 1 994). The resulting recombinant MAP2 was shown to react 
with sera from C. ruminantium-'mfected animals (Mahan et al., 1994). The objective of this 
study was to examine whether MAP2 can be used as antigen in a sensitive and specific 
serodiagnostic test for heartwater. 



3 
Background 

The Family Rickettsiaceae comprises three tribes Ehrlichieae, Rickettsieae, and 
Wolbachieae. Ehrlichia, Neorickettsia, and Cowdria are the three genera in the tribe 
Ehrlichieae, which contain the obligate intracellular bacterial parasites with a tropism for 
leukocytes and endothelial cells (Rikihisa, 1991). Members of the tribe are tiny Gram- 
negative cocci and are found in membrane-lined vacuoles within the cytoplasm of infected 
eukaryotic host cells. Originally Cowdria was classified in the tribe Chlamydieae, Family 
Phagosomaphilaceae (Scott, 1 987). However, phylogenetic studies demonstrated clearly that 
Cowdria was different from the Chlamydieae (Dame et ah, 1992; Van Vliet et al., 1992). 

Cowdriosis was originally reported in South Africa in 1838 by Voortrekker pioneer 
Louis Trichardt who described this disease (nintas) as fatal to sheep following massive tick 
infestation with ticks (Provost and Bezuidenhout, 1987). The distribution of C. ruminantium 
was similar to that of its vectors of the genus Amblyomma and has been identified in Sub- 
Saharan Africa and on several surrounding islands (Madagascar, La Reunion, Mauritius, the 
Comoros, Zanzibar, and Sao Tome) (Walker and Olwage, 1987; Flach et al., 1990; 
Uilenberg, 1 983). In addition, the organism has been isolated from animals on several islands 
in the Caribbean region where Amblyomma variegatum has become established (Perreau et 
al, 1980;Burridge, 1985). 

Heartwater was believed to have become established on the island of Guadeloupe in 
the early 1800s during importation of cattle from Senegal (Barre et ah, 1987). The tick has 
now been identified on Antigua, Martinique, Marie-Galante, Nevis, St. Martin, St. Lucia, St. 
Croix, and Puerto Rico (Burridge et al, 1984). The impact of heartwater on populations of 



4 
animals in the Caribbean coupled with the threat of the disease to the Americas led to 
development of an eradication program throughout the region. 

Although eradication of A. variegatum was accomplished on many islands, prevention 
of re-infestations has been extremely difficult. After two previous eradications (1970, 1987) 
on the U.S. Virgin Island St. Croix in 1993, a tick was found on a stray female Senepol calf. 
Approximately one month later, cattle were infested with engorged females. Fortunately, 
heartwater has not been observed. As a result of these infestations, the United States 
Department of Agriculture (USDA) and the St. Croix Department of Agriculture have once 
again eradicated the tick from this island (unpublished information). 

Important factors contributing to the spread of C. ruminantium on Guadeloupe 
include (1) a highly virulent isolate, Gardel; (2) a resistant bovine population that is capable 
of maintaining the organism with little or no signs of infection; and (3) an optimal 
environment for the vector (Camus and Barre, 1987). Initially, movement of domestic 
animals between islands (livestock and dogs) may have played a role in the dissemination of 
A. variegatum (Camus and Barre, 1990). However, the introduction of ticks to various 
islands has continued despite development of regulations preventing the movement of animals 
between islands (Drummond and Butcher, 1988). The cattle egret (Bulbulcus ibis) may be 
a new source of tick dispersal. Egrets have been shown to migrate between islands and carry 
instars of A variegatum (Uilenberg, 1990). Egret migration poses a problem to eradication 
programs because of the inability to destroy ticks associated with this bird. The seriousness 
of the problem has been reported recently by the University of Georgia, the USDA, the 
United States Fish and Wildlife Service (USFWS), and the Institute d'Elevage et de Medecine 



5 
Veterinaire des Pays Tropicale (EMVT). When they examined cattle egret movement 
between islands using colored tags (Corn et al, 1993), 30% of the marked birds migrated 
between islands, including the identification of one bird from Antigua on Long Key, Florida. 

Inadequate diagnostic tests may allow for importation of heartwater-infected animals 
into heartwater-frees areas. Heartwater has been identified in several species of buffalo and 
antelopes (Uilenberg, 1983; Okoh et al., 1987), including black wildebeest Connochaetes 
gnou, blesbuck Damaliscus dorcas, springbuck Antidorcas marsupialis, eland Taurotragus 
oryx, bushbuck Tragelaphus scriptus, sitatunga Tragelaphus spekei, blackbuck Antilope 
cervicapra, and giraffe Giraffa camelopardalis. Andrew and Norval (1989) reported that 
African buffalo (Syncerus caffer) became carriers of heartwater after recovery from the 
disease. The status of infection in wild animals is important to determine because they may 
act as carriers or reservoirs of the agent and may result in the introduction of heartwater into 
the United States. 

The discovery of C. ruminantium-'mfected non-ruminants, such as rodents, guinea 
fowl, and leopard tortoises (Bezuidenhout and Olivier, 1985) was important in understanding 
transmission of heartwater. Instars of A. hebraeum and A. marmoreum are commonly found 
on goats, tortoises, and guinea fowl and may effect exchange and maintenance of C. 
ruminantium between these vectors and their hosts (Dower et al, 1 988). Cowdriosis is a 
major disease of livestock with high morbidity and mortality for populations of ruminants 
originating from heartwater-free areas and for populations of small ruminants in endemic 
areas (Uilenberg, 1983). Acute cowdriosis results in mortalities of 20% to 90% in 
susceptible livestock populations (Uilenberg, 1983). Its common name "heartwater" was 



6 
derived from one of the prominent lesions, hydro pericardium, observed in animals that have 
died of this disease (Henning, 1957; Prozesky, 1987). Other lesions include ascites, 
hydrothorax, mediastinal edema and edema of the lungs (Uilenberg, 1 983). Subendocardial, 
submucosal and subserosal hemorrhages are usually seen (Mare, 1 984). Degeneration of the 
myocardium and liver parenchyma, splenomegaly, edema of the lymph nodes, enteritis and 
catarrhal and hemorrhagic abomasitis are all encountered commonly (Alexander, 1931; Mare, 
1 984). Brain congestion occurs, but brain lesions are remarkably few when one considers the 
severity of the nervous symptoms observed in this disease (Pienaar et al., 1966). 
Microscopically, colonies of the organism are observed in capillary endothelial cells of 
different tissues including the cerebral cortex and renal glomeruli (Cowdry, 1926). These 
macroscopic and microscopic lesions have been observed also in white-tailed deer 
experimentally infected with C. ruminantium (Dardiri et al., 1987). 



7 



Justification 



The presence of the etiological agent and vector in the Caribbean islands poses a 
threat of introduction of heartwater into the Americas. Fundamental to the prevention of the 
spread of the disease is development of a diagnostic test that could be used to screen 
imported animals from Africa and provide continuous surveillance of animals from the 
Caribbean. Existing diagnostic methods using whole organisms, MAPI, or genes lack 
specificity (IF As and cELISAs) or sensitivity (DNA probes) or require equipment unavailable 
to most areas affected by the disease (PCR). The development of a specific and sensitive 
diagnostic test may be dependent upon the development and purification of recombinant 
major antigenic protein 2 (rMAP2) of C. ruminantium. This protein has been used as antigen 
in an indirect ELISA and a competitive ELISA, both applicable tests when dealing with a 
number of samples from different hosts. In this study, examination of the map2 gene at the 
molecular level was accomplished to determine the uniqueness of the protein in comparison 
to homologous proteins in Ehrlichia spp. 

Research Objectives 
The overall goal of this dissertation was to determine the usefulness of MAP2 in heartwater 
diagnosis. The specific aims to achieve these goals were: 

[l.J To determine the conservation of the gene encoding MAP2 of C. 
ruminantium among several geographic isolates (by the amplification, cloning, 
mapping, and sequencing of the map2 gene fragment of different isolates of 
C. ruminantium); 



8 
[2.] To examine the sensitivity and specificity of MAP2-based serological assays; 

[3.] To evaluate the MAP2 homologs of two closely related Ehrlichia species, E. 

canis and E. chaffeensis (by the amplification, cloning, mapping and 

sequencing of wop2-like DNA encoding the homologous protein(s) in E. 

chaffeensis and E. canis); and 
[4.] To compare the sequences obtained from the C. ruminantium isolates with 

those obtained from E. chaffeensis and E. canis and identify unique sequences 

and antigenic regions of MAP2 of C. ruminantium. 






CHAPTER 2 
LITERATURE REVIEW 

Epizootiology 

Heartwater is distributed throughout sub-Saharan Africa, Africa' s surrounding islands 

and in some Caribbean islands (Uilenberg, 1983). The presence of C. ruminantium follows 

the presence of tick vectors of the genus Amblyomma; thus, suitable environments and hosts 

for vectors are adequate for maintenance and transmission of the organism. The 

epizootiology of cowdriosis is primarily affected by the biology and distribution of the vector, 

and by the parasite-host, vector-host and parasite-vector interactions. 

Biology and Distribution of the Vector 

In 1 925(b), E. V. Cowdry of the Rockefeller Institute for Medical Research elucidated 
the mode of transmission of C. ruminantium by A. hebraeum, a three-host tick of the genus 
Amblyomma (Ixodidae, Ixodideae, Acarina). Presently, thirteen species of Amblyomma have 
been demonstrated to be vectors or potential vectors of the organism. Many of these species 
occur in sub-Saharan Africa and Africa's surrounding islands (Perreau et ah, 1980). 
However, heartwater is well documented in the Caribbean on the islands of Antigua, 
Guadeloupe and Marie Galante (Barre et al., 1987), where A. variegatum has been 
recognized as a vector for many years. It is suspected that this tick was introduced with a 
shipment of cattle from Senegal in the 1830s (Curasson, 1943); however, a separate 



10 
introduction of A. variegatum onto St. Lucia may have occurred (Estrada-Penae/a/., 1994). 
The basis for this theory is significant variations between two populations of A. variegatum 
from Guadeloupe and St. Lucia by analysis of cuticular hydrocarbon. In addition, based on 
the analysis of map 1 genes of C. ruminantium isolates from Guadeloupe and Antigua and 
their relation to African isolates, Reddy et al. (1996) have suggested that two separate 
introductions of C. ruminantium into the Caribbean took place. 

Ten African species of Amblyomma are vectors for C. ruminantium: A. variegatum, 
A. hebraeum, A. lepidum, A. cohaerens, A. astrion, A. pomposum, A. marmoreum, A. 
sparsum, A. tholloni, and A. gemma (Uilenberg, 1983). The tropical bont tick, A. 
variegatum, is distributed throughout sub-Saharan Africa extending outside of the continent 
eastward to the Yemen Arab Republic and to the islands of Madagascar, Reunion, Mauritius, 
westward to Cape Verde islands, and to some of the Caribbean islands (White, 1983). 
Amblyomma hebraeum, the South African bont tick, is distributed throughout most of 
southern Africa and has a higher susceptibility to infection with geographically different C. 
ruminantium isolates than A. variegatum (Walker and Olwage, 1987; Mahan et al., 1995). 
Amblyomma gemma and A. lepidum have been important in outbreaks of heartwater in 
Ethiopia, Somalia, Kenya and Tanzania, and the Sudan, respectively (Yeoman and Walker, 
1967; Walker and Olwage, 1987). Other reported natural vectors included, astrion on Sao 
Tome and Principe (Uilenberg, 1982) and A. pomposum in Angola (Neitz, 1947). All other 
species are experimental vectors (Walker and Olwage, 1987). 

Three species of Amblyomma (A. maculatum, A. dissimile, and A. cajennense) have 
been shown to be capable of transmitting C. ruminantium in the United States (Uilenberg, 



11 

1982, 1983; Jongejan, 1992). Common on livestock and white-tailed deer Odocoileus 
virginianis, A. cajennense occurs in southern Texas and A maculatum (the Gulf Coast tick) 
in eastern, southern and western United States (Bishopp and Trembley, 1945; Clifford et al, 
1961; Cooney and Burgorfer, 1974; Samuel and Trainer, 1970; Strickland et al, 1981; 
Durden et al., 1991). Experiments with A. maculatum were performed to demonstrate 
transstadial transmission from larva to nymph to adult. Amblyomma maculatum was 
determined to be as good a vector for C. ruminantium as A. hebraeum (Uilenberg, 1982). 
Amblyomma dissimile, the American reptile tick, generally feeds on reptiles and amphibians; 
thus, its potential role in the maintenance of C. ruminantium in reptile populations may be 
significant (Jongejan, 1992). All three species of ticks may be important in the spread and 
maintenance of the disease if transported either via infected animals or infected ticks onto the 
Americas. A. americanum, the Lone Star Tick, which is located throughout the southeastern 
and south-central region of the U.S. and is a vector for the agents of Lyme borreliosis and 
human monocytic ehrlichiosis, has been demonstrated to be infected by C. ruminantium after 
feeding on infected animals; however, no transmission has been observed when these ticks 
were fed on susceptible hosts (Mahan, unpublished data). 

The presence of potential American vectors of C. ruminantium and experimental 
studies showing the susceptibility of white-tailed deer to C. ruminantium and its disease 
(Dardiri et al., 1987) support the need for a reliable diagnostic test. When wildlife from 
heartwater-endemic countries are relocated in regions (i.e. southeastern U.S.) where both 
potential vectors and susceptible wildlife exist, outbreaks of heartwater may possibly occur, 



12 
in addition, surviving animals could maintain and transmit the disease throughout the 
American continent. 

The life cycles of A. hebraeum and A. variegatum may take from 5 months to 3 years 
to complete depending on the environment (habitat and climate) (Petney et ah, 1987). Since 
a tick may pick up the infection as a larva or nymph, and transmit it as a nymph or adult, the 
infection can persist in the tick for a very long time. Since these ticks are multi-host, they can 
feed on a wide variety of livestock, wild ungulates, ground birds, small mammals, reptiles and 
amphibians, thus making control strategies difficult. 

Transmission of C. ruminantium is primarily transstadial; however, male ticks transmit 
intrastadially as well (Andrew and Norval, 1 989). Transstadial transmission can be complete 
(i.e. from larva to nymph, from nymph to adult, or from larva through nymph to adult) or 
incomplete (from larva to nymph or from nymph to adult) (Bezuidenhout, 1987). 
Transovarial transmission of organisms from infected female ticks to their offspring is rare 
(Bezuidenhout and Jacobz, 1 986); thus, it does not play an important role in the transmission 
cycle. 

Parasite-Host Interactions 

Ticks infected with C. ruminantium feed on a variety of host species including 
domestic and wild ruminants and release organisms during ingestion. C. ruminantium travels 
through the blood as single bodies or as very small clumps (Cowdry, 1926). The organisms 
then enter vascular endothelial cells, neutrophils, macrophages and reticuloendothelial cells 
(Prozesky and Du Plessis, 1987) through a process resembling phagocytosis and proliferate 



13 
primarily by binary fission (Pienaar, 1970; Prozesky et al., 1986). Several forms of C. 
ruminantium occur including electron-dense (elementary), intermediate and reticulate bodies; 
however, usually only organisms of the same form are found in a particular vacuole of the cell 
(Prozesky, 1987). The role of the bodies is unclear since it is difficult to separate them from 
their clusters. However, reticulated bodies are hypothesized to be a vegetative stage of the 
organism (Prozesky and Du Plessis, 1987). Electron-dense bodies increase in size and 
undergo division to form fragmented dense bodies. These subdivide and become organized 
to give rise to mature organisms. 

Each organism is surrounded by a double membrane and a capsule has been reported 
around a few organisms in vitro (Prozesky, 1987). C. ruminantium released from 
reticuloendothelial cells subsequently penetrates endothelial cells where further multiplication 
occurs (Prozesky and Du Plessis, 1987). 

Release of the organisms from the endothelial cell and host immune responses cause 
the pathogenicity of the disease. These responses differ significantly depending on the isolate 
of C. ruminantium (Du Plessis et al., 1989). Du Plessis et al. (1987b) reported that a 
hypersensitivity-type reaction may be the basis for the pathogenesis of heartwater, especially 
since only mild cytopathic changes are observed in parasitized cells (Prozesky, 1987). This 
may explain why macroscopic lesions include effusion from body cavities and edema of the 
lungs and lymph nodes; however, further studies on pathogenesis are needed. 

Because mice can be infected with C. ruminantium, certain murine strains (Balb/C, 
CBA/CA, C57/BL6, DBA/2, CD1, C3H/HE) have been used to study the pathogenesis. 
Gross and microscopical lesions in mice closely resemble the lesions described in cattle, sheep, 



14 

and goats except there is a high concentration of organisms present in alveolar endothelial 

cells (Prozesky and Du Plessis, 1985). 

Ilemobade and Blotkamp (1978) studied goats to outline the clinical pathological 

features. The following was observed: 

a significant drop in hemoglobin values and marked leukopenia caused by lymphopenia and 
neutropenia and a fall in total serum protein during the course of the disease. A significant 
increase in a-globulins and an apparent decrease in y-globulins also occurred. Marked 
depletion of lymphocytes in the follicles of spleen and lymph nodes was observed in 
histological sections. A dramatic rise in blood levels of glucose, pyruvate, and lactate, and 
a drop in blood pH occurred terminally and appeared to contribute to the fatal outcome of the 
disease (p.43). 

Interpretation of these results suggests the presence of other chemotactic, hemopoetic, and 
immunological factors possibly influenced by cells infected by C. ruminantium. 

Vector-Parasite Interactions 

After ingestion by ticks in a blood meal, organisms invade gut epithelial cells and 
multiply; subsequent stages invade and develop in the salivary acini cells (Prozesky and Du 
Plessis, 1987). Kocan and Bezuidenhout (1987), using electron microscopy, observed 
colonies in the gut of unfed and feeding ticks. Mallory's phloxine-methylene blue stain 
differentiates colonies of C. ruminantium in the midgut epithelial cells of nymphal A. 
hebraeum that had been infected as larvae (Yunker et al., 1987). Nymphal ticks which had 
only colonies in the gut, after four days of feeding, had colonies also in their salivary gland 
acini (Kocan et al., 1987), which supports the theory that transmission stages appear to be 
coordinated with the feeding cycle of the ticks (Prozesky and Du Plessis, 1987). 



15 
Many studies have involved examination of the organism in the vector. Besides the 
gut and salivary glands, colonies have been demonstrated microscopically in hemocytes and 
malpighian tubules of infected Amblyomma ticks (Kocan and Bezuidenhout, 1 987; Kocan et 
al, 1987; Viljoen et al, 1988). As in the host, the electron-dense and reticulated forms are 
observed in the gut; in the salivary glands, most are in the reticulated form, which is believed 
to be the infective form of the organism. The membrane-bound reticulated colonies in the 
salivary glands contain pleomorphic organisms which actively divide by binary fission; i.e., a 
developmental cycle for C. ruminantium occurs in the invertebrate host (Kocan et al., 1987; 
Kocan and Bezuidenhout, 1987). In recently fed ticks, many of the colonies have large, 
electron-dense inclusions that are morphologically similar to deposits of hemoglobin found 
in the cytoplasm of midgut epithelial cells (Kocan et al, 1987). 

Host- Vector Interactions 

Ticks are the most important ectoparasites of livestock in the tropical and subtropical 
regions of the world (Uilenberg et al, 1992). They are responsible for the transmission of 
diseases such as babesiosis, anaplasmosis, theileriosis, and cowdriosis, as well as a significant 
reduction in live weight gain, milk yield and calf damage to the cattle industry (Zwart and 
Buys, 1968; Uilenberg et al, 1984, 1992; Norval et al, 1989). Hide and udder damage, an 
entry region for screw-worm attack, and secondary bacterial infections have been reported 
(Uilenberg et al, 1992). 

Major factors which affect the number of Amblyomma ticks found on hosts include, 
but are not limited to, host resistance and grooming, human intervention (primarily acaricide 



16 
usage), and the distinct signaling behavior of the ticks (Matheron et al., 1 991 ; Yunker et al., 
1991; Norval etal., 1989a, 1989b). 

Most tick-infested cattle mount an immune response to tick antigens such as salivary 
components (De Haan and Jongejan, 1990). Hypersensitivity reactions at the site of the bite 
provoke individual or mutual grooming behaviors which can result in ticks either being 
dislodged or squashed (Norval, 1992). A decrease in the percent of ticks surviving after 
attachment and a reduction in engorged weight of larvae, nymphs, and females result in either 
lower survivability and lower capacity at the next feed (larvae and nymphs) or the production 
and development of fewer viable eggs (Norval, 1978). 

Control of heartwater has been by the use of acaricide either by dipping or spraying 
to control tick numbers. Although acaricides are effective, they are expensive, residuals may 
contaminate meat and milk, and ticks often become acaricide-resistant. In Swaziland, a small 
land-locked country in Southern Africa, 40% of the budget for the Ministry of Agriculture 
went to the tick control program in 1 99 1 (Ramsay, 1 992). From personal observations, many 
of the acaricides are destructive to the environment resulting in degradation of land and loss 
of grazing land for animals which the acaricides were developed to protect. 

The signaling behavior of members of the genus Amblyomma has been critical for the 
attraction of the tick to a suitable host. Feeding male ticks are attractive to unfed adult ticks 
due to the emission of attraction-attachment pheromones (Rechav e/ al, 1976; 1997). These 
pheromones allow unfed ticks to discriminate between suitable hosts and potentially 
unsuitable hosts (Norval et al, 1989). 









17 
Hosts have included, in addition to exotic and indigenous breeds of cattle, sheep, and 
goats, several species of indigenous antelope (Kock et al, 1995). These wild species have 
been implicated in the maintenance and transmission of the organism including the blesbok 
(Damaliscus albifrons), the black wildebeest (Connochaetes gnu) and the springbok 
{Antidorcas marsupialis), which have been experimentally shown to be susceptible to the 
disease (Neitz, 1935; Uilenberg, 1983). 

Control of Heartwater 
Control of heartwater has been primarily by the use of acaricidal dips and vaccines. 
However, strategic dipping is being practiced in enzootically stable regions in many countries 
as a form of control for cowdriosis. 

Clinical Manifestations 

Cowdriosis can be manifested clinically in four forms— peracute, subacute, mild 
(subclinical) and acute (Mare, 1984; Van de Pypekamp and Prozesky, 1987). Clinical forms 
primarily depend on the susceptibility of the host, quantity of organisms during exposure, 
route of infection, and virulence of the isolate (Alexander, 1931; Neitz, 1968; Uilenberg, 
1983). The peracute form, consisting of a febrile response and convulsions followed by 
sudden death, is observed in susceptible animals introduced into a heartwater enzootic region 
(Henning, 1956; Van der Merwe, 1979). The subacute form is characterized by pyrexia, 
respiratory distress, and mild incoordination, with either recovery or death occurring up to 
two weeks after initial observation (Mare, 1984). The mild or subclinical form is observed 



18 

primarily in wild ungulates, in young animals with innate resistance, and in reinfected animals 

and may involve a mild febrile reaction (Mare, 1 984; Van De Pypekamp and Prozesky, 1 987). 

The more common acute form involves a sudden febrile reaction followed by 
inappetence, depression, listlessness, rapid breathing and nervous signs including chewing 
movements, blinking, tongue protrusion and circling with high stepping gaits. While many 
of the early signs continue to persist, muscle twitches, galloping, opisthotonos, hyperesthesia, 
nystagmus (involuntary oscillations of the eyeballs) and frothing from the mouth are often 
observed in the terminal stages (Spreull, 1922; Van de Pypekamp and Prozesky, 1987). 
Finally, the animal becomes recumbent in convulsions (Mare, 1984). The acute form is 
usually fatal within a week of the onset of signs. Experimentally, febrile reactions are 
observed between seven and ten days in sheep and ten and 16 days in cattle (Mare, 1984). 
Under field conditions, susceptible animals can be expected to show signs of the disease 9 to 
29 days after introduction into a heartwater- infected area (Alexander, 1931). 

Unlike adult cattle, calves under the age of one month, irrespective of the immune 
status of the dam, have been observed to possess innate immunity (Neitz and Alexander, 
1945; Du Plessis and Malan, 1987b; 1988). A longer level of immunity (up to 6 to 9 weeks 
of age) was suggested for calves from heartwater-immune dams; colostrum-derived C. 
ruminantium-spec]fic immune factors have been reported as the reason for this protection 
(Deem et al, 1996a). In addition. Deem et al (1996b) demonstrated vertical transmission 
by infected dams to their calves by possible oral uptake of C. ruminantium in colostrum. C. 
ruminantium has been observed in neutrophils and macrophages (Sahu, 1986; Logan et al, 
1 987) and may be present in bovine colostrum (Lee et al, 1 980). Thus, there is an increased 



19 
possibility that calves born and raised in enzootic areas are protected via colostrum against 
C. ruminantium and hence are less likely to demonstrate clinical reactions to the disease. 

Animals recovering from disease develop an isolate-specific immunity that protects 
them from future clinical illness (Jongejan et al, 1993; Audu et al, 1995; Pipano, 1995). 
Many of those recovered animals remain chronically infected and are considered carriers, 
without signs of clinical infection or microscopically detectable parasitemias (Barre and 
Camus, 1 987). Andrew and Norval (1989) demonstrated this carrier state in sheep, cattle and 
African buffalo that had recovered from heartwater and from which the organism was 
transmitted by nymphs of A. hebraeum. Carrier animals may be important reservoirs for C. 
ruminantium. 

Therapy 

Several therapeutic drugs, including sulfonamides (Neitz, 1940) and tetracyclines 
(Mare, 1 972), are available for the treatment of cowdriosis. Early treatment with tetracycline 
has been shown to be very effective in the suppression of clinical disease (Purnell et al., 
1989). However, administration of tetracycline before clinical signs may reduce the 
establishment of immunity. Many studies have been done to test these tetracyclines for short- 
and long-term efficacy, when administered intravenously, or as slow-releasing doxycycline 
implants that can be administered subcutaneously (Olivier et al., 1988; Purnell et al., 1989). 



20 
Vector Control 

Control of heartwater by tick eradication has focused on application of acaricides in 
sprays and dipping tanks. However, acaricide application has often been ineffective because 
three-host ticks have a high rate of reproduction, acaricide resistance, and various instars feed 
on a variety of (wild and stray) hosts (Bezuidenhout and Bigalke, 1987; Petney and Horak, 
1987). 

Control measures using acaricides are often contraindicated because (1) the herd is 
not immune and hence animals are vulnerable to the disease when tick control breaks down 
and (2) interruption in acaricide application due to mechanical failure of equipment, foreign 
exchange restrictions or political instabilities may result in losses due to host susceptibility 
(Norval, 1 979). Intensive tick control is also expensive, causes acaricide residues in meat and 
milk and results in degradation of land (Norval et ai, 1992). Strategic dipping based on 
fluctuations in the number of vectors during different seasons of the year has been suggested 
and is practiced in several countries as a means of control of heartwater (Norval et al., 1 992). 

Vaccines 

In 1931, Alexander developed a live vaccine for cowdriosis using infected blood 
(inoculum) that was administered intravenously. This method was the primary vaccine used 
until 1981 when Bezuidenhout introduced the use of homogenized C. ruminantium-'mfected 
nymphs as inoculum in an attempt to reduce the costs for production of the vaccine. 
However, both live, virulent vaccines were associated with problems. 



21 

Techniques used to produce the blood and nymph vaccines were similar. The two 
techniques differed only in the production of the working antigen and selection and 
preparation of the appropriate isolate, and production and storage of the isolate antigen 
(Oberem and Bezuidenhout, 1987). Vaccination was done using deep-frozen animal blood 
containing an isolate of live heartwater organisms. Immunization was accomplished by the 
intravenous inoculation of infected blood into livestock followed by treatment with 
tetracyclines, by infection and block method in which livestock was inoculated and treated at 
the same time (Fivaz, 1990). With all of these methods, treated/vaccinated animals must be 
closely monitored for febrile reactions. 

The infection and treatment method (Van der Merwe, 1 987) was the method of choice 

and is described as follows: 

The infect and treat method involves the inoculation of animals followed by the daily 
monitoring of animals for an increase in temperature. At the onset of a febrile reaction, the 
animal must be treated with tetracycline or its equivalent. Animals are protected from that 
stock of Cowdria. The danger with this method is that it can only be done on a few animals 
because of the daily monitoring of large numbers could result in tedious work (p. 489). 

In South Africa, the infection and treatment method is commonly practiced 
(Bezuidenhout, 1989). The optimal regimen for controlling reactions is to vaccinate the 
animals in small groups and to record rectal temperatures daily from 7-28 days after 
vaccination (Bezuidenhout, 1989). Cattle are treated on the first or second day of displaying 
an elevated temperature (over 39.5 °C). Even under careful supervision, some mortality 
occurred, occasionally reaching 5% in adult animals (Barnard, 1953; Sutton, 1960). For 
example, 0.6% of 462 C. ruminantium-nnmunized, febrile-reacting crossbred zebu cattle died 
due to heartwater while using the infection and treatment method (Lawrence et al., 1995). 



22 

The infection and block method (Du Plessis and Malan, 1 987c) involves simultaneous 
inoculation of animals followed by treatment with tetracycline. This method may result in 
mortality due to early febrile reactions or loss of immune protection of animals treated before 
the onset of disease. 

Animals recovering from naturally or artificially-induced disease are rendered solidly 
immune for a variable period, ranging from 6 to 18 months. Exposure of animals to 
reinfection during this period of resistance will boost the immune response and periodic 
reinfection will insure continued immunity (Norval et al., 1990). The actual mechanism of 
immunity is obscure. Immunoglobulins transferred from heartwater-immune animals to 
susceptible ones did not protect against clinical heartwater infection (Stewart, 1 987). When 
young animals were inoculated intravenously with heartwater-infected blood (Uilenberg, 
1 990), mild disease occurred. Upon recovery, these animals were immune to reinfection as 
long as their immunity was continuously stimulated by natural exposure to the organism 
(Uilenberg, 1990). Monitoring of older animals or valuable calves was done daily and these 
animals were treated with tetracycline as soon as they became febrile (Fivaz, 1990). 

Inactivated vaccines made from C. ruminantium cultured in vitro (Byrom and Yunker, 
1990) were tested successfully against experimental (Martinez et al, 1994; Mahan et al, 
1995) and field tick challenge (Mahan, unpublished) but have not been marketed 
commercially. Cell culture-derived vaccines are likely to be less expensive, safer and simpler 
to produce and market than live vaccines. 



23 
Enzootic Stability 

Enzootic stability occurs when animals become infected with C. ruminantium and 
recover without becoming significantly ill, thus developing immunity to the disease (Du 
Plessis et al., 1992). Enzootic stability with minimal losses is most successfully established 
when initial infection occurs during the first weeks of life (natural immunity) or by artificial 
immunization. Although enzootic stability does not decrease incidence of disease, mortality 
is often greatly reduced (Mare, 1 984). In enzootic areas, populations of ticks are maintained 
by strategic dipping or spraying to insure minimal exposure of immune animals, thus 
providing reinforcement of immunity. 

Diagnosis of Cowdria ruminantium 

Tentative field diagnosis of heartwater infection was often by identification of the 
vector, characteristic signs and lesions, which must then be confirmed by demonstration of 
the organism (Alexander, 1 93 1 ). Definitive diagnosis was either by brain biopsy (Purchase, 
1945) or serodiagnostic tests utilizing antigen isolated from C. ruminantium-irrfected cells 
from infected hosts or vectors, because in vitro cultivation had not been accomplished. 

Schreuder (1980) reported a simple technique for the collection of brain samples for 
the post-mortem diagnosis of heartwater using a sharp spoon and a knife. "After the head has 
been removed ... a sample of cortex is collected with the spoon through the foramen 
occipitale, thus obviating the need for opening the skull itself' (Schreuder, 1980). 

Examination of live animals suspected to be infected with the heartwater agent was 
done using a brain biopsy technique involving the removal of a small sample of the cerebral 



24 
cortex (Synge, 1978). The organism was then identified by microscopic examination of 
Giemsa-stained brain smears (Jackson, 1931; Jackson and Neitz, 1932). Clumps of blue to 
reddish-purple organisms occur in capillary endothelial cells using an oil immersion lens. 
Organisms were demonstrated also in smears prepared from the intima of large blood vessels 
or in stained sections of kidney glomeruli and lymph nodes (Cowdry, 1926; Jackson, 1931; 
Du Plessis, 1970). Animals with mild or atypical infections may remain undiagnosed 
(McHardy and MacKenzie, 1984). The epizootiological picture of heartwater is unclear 
because of this variability in clinical manifestations. Presently, the "gold standard" for 
confirmation of infection is by subinoculation of fresh blood into a susceptible animal with 
subsequent demonstration of clinical disease (Ilemobade and Blotkamp, 1976). 

Serodiagnostic tests were developed using antigen obtained from infected hosts or 
vectors, including a capillary flocculation test using antigen prepared from the brains of 
infected animals (Ilemobade and Blotkamp, 1976) and a complement fixation test using 
infected brain and blood cells as antigen (Musisi and Hussein, 1985). 

Isolation of C. ruminantium from either host tissues or ticks was done by percoll 
density gradient centrifugation, (Neitz et al, 1986a), immunoadsorbent affinity 
chromatography (Neitz and Vermeulen, 1987), lectin cellular affinity chromatography 
(Vermeulene/ al, 1987), and density gradient centrifugation (Neitz et al, 1987). Based on 
the isolation of these antigens, a number of serological assays were developed to detect C. 
ruminantium antibodies in animals (Oberem et al, 1984; Viljoen et al, 1985; Neitz et al, 
1986b). In 1986b, Neitz et al. reported a sensitive and reliable ELISA for the detection of 
antibodies to C. ruminantium in serum by using organisms from nymphs of A. hebraeum 



25 
partially purified by wheat-germ lectin affinity chromatography. The presence of C. 
ruminantium in the blood fractions of diseased animals was demonstrated by an ELISA 
(Viljoen et al., 1987). 

In 1985, Bezuidenhout et al. succeeded in cultivating continuous cultures of C. 
ruminantium in bovine endothelial cells in vitro. The culture-derived organisms were then 
used for development of several diagnostic tests for heartwater including an indirect 
fluorescent antibody assay (IFA) for detection of antibodies against the whole organisms and 
immunoblots for detection of antibodies produced against defined proteins (Jongejan and 
Thielemans, 1989; Rossouw et al., 1990) and the 32 kD protein-specific cELISA (Jongejan 
et al., 1991). Cultivation of the organism has made it possible to obtain large quantities of 
antigenic material for serological tests and immunizations. In addition, genomic DNA could 
be isolated for use in developing DNA probes and possibly recombinant or molecular 
vaccines. 

With the successful cultivation of organisms came the development of immunoassays 
for diagnosis of heartwater. Many indirect fluorescent antibody tests using different types of 
cells (neutrophils, macrophages, and endothelial cells) for cultivation were described. Du 
Plessis (1987) reported the application of an IFA test using antigen isolated from peritoneal 
macrophages of mice infected with the Kumm isolate of C. ruminantium in heartwater 
research. Developers of this test boasted high specificity and sensitivity and possible 
usefulness in the epizootiology of the disease, determination of the infection rate of vectors, 
and the evaluation of immunization studies (Du Plessis and Malan, 1987a). Logan et al. 
(1986, 1987) developed an IFA test using C. ruminantium-infected caprine neutrophilic 



26 
granulocytes; however, neutrophils are end stage cells and cannot be maintained in culture for 
more than a few days (Cline, 1975). 

Bezuidenhout et al. (1985, 1987) subsequently cultivated several isolates of C. 
ruminantium in endothelial cells that provided an inexpensive source of antigen. Yunker et 
al. (1988) modified the methods of Bezuidenhout et al. (1985) and thus was able to cultivate 
14 isolates of C. ruminantium. In addition, they developed an IFA test using cultures of C. 
ruminantium-'mfected bovine aortic endothelial (BAE) cells as antigens. Using this system, 
an IFA test using BalD-, Crystal Springs-, Highway-, Lemco T3- or Palm River- infected BAE 
cells was developed and used to detect antibodies to C. ruminantium in several breeds of 
cattle experimentally infected with Palm River or Ball3 isolates of C. ruminantium. The BAE 
cells yielded large quantities of antigen and supported the growth of fourteen African and 
Caribbean isolates of C. ruminantium (Semu et al, 1992). 

In vitro cultures were used for studies on the antigenic composition of C. 
ruminantium. Proteins were isolated which could be used in the development of a diagnostic 
test. In 1 989, Jongejan and Thielemans identified a periodate-resistant, proteinase K-sensitive 
immunodominant antigen of 32,000 daltons (MAPI) and found it to be conserved among 
both African and Caribbean isolates. A competitive ELISA using MAPI isolated from 
sonicated endothelial cell cultures for antigen and a monoclonal antibody reacting with this 
protein (Jongejan et al., 1991). Muller Kobold et al. (1992) reported the distribution of 
heartwater in the Caribbean based on the detection of antibodies to the conserved MAPI . 

In 1993, it was discovered that false positives occurred in field sera when MAPI of 
C. ruminantium was used in serologic tests (Mahan et al, 1993). In addition, a MAPI 



27 
homolog was present within the genus Ehrlichia (Jongejan et al., 1993). These scientists 
disputed earlier results which suggested a wider distribution of C. ruminantium in the 
Caribbean and questioned the reliability of current serological assays for heartwater. 
Antibodies in the sera of domestic ruminants that were infected with Ehrlichia bovis and 
other ehrlichial agents reacted when the Kumm isolate of C. ruminantium was used as antigen 
in the IFA test and when the BalB isolate was used in an ELISA. Both the IFA and cELISA 
were used in serological surveys, but both tests apparently lacked sensitivity and specificity 
required for accurate epizootiological surveys. 

The ability to detect C. ruminantium is of major importance for epizootiological 
studies and control strategies. The development of nucleic acid-based diagnostic methods 
that are specific and sensitive for detection of C. ruminantium in both recently- infected and 
carrier animals are needed for epizootiology studies. The polymerase chain reaction (PCR), 
involving the thermal denaturation of DNA, annealing of oligonucleotide primers to target 
DNA in a sequence-specific manner, and the synthesis of DNA using DNA polymerase, was 
described (Mullis and Faloona, 1987), which will be valuable to enhance the sensitivity of 
detection. In 1987, Ambrosio et al. (1987), cloned DNA of C. ruminantium isolated from 
in vitro cultivated organisms. However, they contained a large proportion of host DNA. 
Wilkins and Ambrosio (1989) reported the isolation of nucleic acid sequences specific for C. 
ruminantium and proposed the development of twelve clones into DNA probes; however, no 
information is available on these nucleic acid probes (Wilkins and Ambrosio, 1990). 

Another probe, pCS20, was developed and used to determine C. ruminantium 
infectivity in A. variegatum ticks (Waghela et al., 1991), in A. hebraeum (Yunker et al, 



28 

1993) and in sheep (Mahan et al, 1992). The addition of the PCR to DNA probe 
hybridization enhanced the sensitivity of the diagnostic test enabling detection of low 
quantities of C. ruminantium in ticks that were not detected by DNA probes. PCR was also 
useful in detection of C. ruminantium in desiccated ticks and ticks fixed in 70% ethanol, 1 0% 
buffered formalin, or 2% glutaraldehyde (Peter et al, 1995). A second PCR based on the 
mapl sequence was used to identify the presence of C. ruminantium in blood and bone 
marrow samples from healthy, free-ranging Zimbabwean ungulates [tsessebe (Damaliscus 
lunatus), waterbuck (Kobus ellipsiprymnus), and impala (Aepyceros melampus)]. However, 
a specific serodiagnostic test may have several advantages over PCR. Although PCR has 
been useful in detecting ticks infected with C. ruminantium, it has not been as useful as a 
diagnostic tool for the detection of C. ruminantium in host animals. The presence of minimal 
organisms in the blood of carrier animals often resulted in false negative results using PCR. 
C. ruminantium has a tropism for endothelial cells, where they develop and multiply; thus, 
minimal organisms are found in the blood of carrier cattle. The average detection rate for a 
PCR-based assay for the hemoparasite Babesia bovis, which is found in bovine red blood cells 
of experimentally-infected cattle, ranged from 58 to 70% (Calder et al, 1996). In addition, 
assays for serodiagnosis of C. ruminantium may be able to detect infection in carrier animals 
for long periods following acute infection. Antibodies to Anaplasma marginale, a rickettsia 
closely related to C. ruminantium, were detectable for a 5-year evaluation period, despite the 
occurrence of a cyclic rickettsemia in the long-term carrier cattle (McGuire et al, 1991). 
Immunoassays developed for detection of animals infected previously with C. ruminantium 
would be important for regional epizootiological studies. Finally, immunoassays are simpler 









29 
to perform than nucleic acid probe reactions and are less likely to be contaminated (false 
positive) than PCR assays. 

The gene encoding an immunoreactive 21 kD protein (MAP2) of C. ruminantium was 
isolated, cloned and expressed in E. coli (Mahan et al. , 1 994). Recombinant MAP2 was 
shown to react with sera from C. ruminantium-'m&cted sheep, goats, and cattle, suggesting 
that this protein may be useful as a diagnostic antigen (Mahan et al., 1994). In this 
dissertation, the use of native MAP2 or recombinant or synthetic MAP2 homologs for 
diagnosis was investigated. Further evaluation of the protein as an antigen in a serodiagnostic 
assay was warranted because MAP2 was conserved among several isolates of C. 
ruminantium. In addition, this protein is a homo log of the major surface protein 5 (MSP5) 
of the rickettsia Anaplasma marginale (Visser et al., 1992). A competitive ELISA using 
infection antisera to inhibit the reaction between recombinant MSP5 and corresponding 
monoclonal antibody proved to be a sensitive serodiagnostic test for cattle infected with A. 
marginale for up to six years post-infection (Knowles et al., 1996). 

The Research Problem 
The development of a serodiagnostic test for C. ruminantium is essential for 
development of epizootio logical studies and control strategies. Presently, serodiagnostic tests 
have been unreliable because of the occurrence of serologic cross-reactions. Presently, 
molecular diagnostic assays based on PCR and DNA probes for C. ruminantium lack 
sensitivity, especially in carrier animals. Identification of C. ruminantium-umque epitopes on 
immunodominant proteins may be required for development of a serodiagnostic test for 



30 
heartwater. 

In this study, a gene encoding MAP2 of C. ruminantium was sequenced to determine 
the extent of genomic conservation among five geographic isolates of C. ruminantium from 
Zimbabwe and Sudan in Africa and Antigua in the French West Indies. The sensitivity and 
specificity of MAP2-based diagnostic assays were investigated using indirect and competitive 
ELISAs. Finally, the sequences of MAP2 homologs in the related rickettsiae, Ehrlichia 
chaffeensis and E. canis, were determined to provide a basis for developing specific serologic 
assays using defined recombinant or synthetic fragments of MAP2. 









CHAPTER 3 

ANALYSIS OF THE MAJOR ANTIGENIC PROTEIN 2 GENES FROM FIVE 

GEOGRAPHIC ISOLATES OF COWDRIA RUMINANTIUM 

Introduction 

Cowdria ruminantium causes the rickettsial disease, cowdriosis or heartwater, which 
has been identified in sub-Saharan Africa and in the Caribbean (Uilenberg, 1983). The 
presence of C. ruminantium in the Caribbean may be due to: (1) the accidental importation 
in the early 1800s oiAmblyomma variegatum and thus, the organism, on Senegalese zebu 
cattle to Guadeloupe (Curasson, 1943; Perreau et al, 1980) and (2) the movement of birds, 
namely cattle egrets (Bubulcis ibis) harboring instars of A. variegatum, from the African 
continent either by migration or by hurricanes (Palmer, 1962; Albaine Pons, 1980). 
Regardless of how the organism became established in the Caribbean, suitable environmental 
conditions (Sutherst and Maywald, 1985) led to the spread of the vector and ultimately, the 
disease. Unfortunately, diagnostic tests for heartwater were found to be unreliable due to 
poor specificity because of cross-reacting agents (possibly Ehrlichia spp.) in heartwater- free 
and heartwater endemic areas (Du Plessis et al., 1 987a; Mahan et al., 1 993 ; Du Plessis et al., 
1994). Thus, a diagnostic test specific for C. ruminantium is required for epizootio logical 
studies. 

Seven major immunogenic proteins reacted in Western blots with antiserum from a 
hyperimmune sheep infected with the Crystal Springs isolate of C. ruminantium. Three of 

31 



32 






these proteins were cloned (21,32,58 kDas) (van Vliet et al, 1 994; Mahan et al., 1 994; Lally 
et al., 1995). The 32 kDa protein, termed major antigenic protein 1 or MAPI was found to 
be antigenically conserved in nine isolates of C. ruminantium from Africa and the Caribbean 
(Jongejan and Thielemans, 1989) and was used in a cELISA using monoclonal antibodies 
(Jongejan et al., 1991). However, further studies revealed that MAPI also reacts with sera 
from cattle, sheep, and goats from heartwater-free areas of Zimbabwe (Mahan et al, 1993) 
and with several members of the genus Ehrlichia (Jongejan et al, 1 993). Subsequently, the 
presence of genes coding homologous MAPI from two Ehrlichia species, E. canis and E. 
chaffeensis, has been analyzed (Reddy, submitted for publication). Importantly, variability 
in nucleotide sequences of MAPI among four African and two Caribbean isolates ranged 
between 0.6 to 14.0% (Reddy et al, 1996). These nucleic acid differences translated to 
amino acid substitutions, deletions, or insertions at three hypervariable regions of the gene 
(Reddy et al., 1996). Genes encoding the MAPI homologs in Ehrlichia species also had 
hypervariable sequences at the same regions of the gene as C. ruminantium. Demonstration 
of both homology in MAP 1 coding sequence between C. ruminantium and Ehrlichia spp. and 
divergence in hypervariable region between isolates suggest that MAPI may not be useful as 
an antigen for serodiagnosis of heartwater. The second protein, 58 kDa, was found to be a 
heat shock protein (Lally et al, 1995) which was unlikely to be useful for serodiagnosis 
because of sequence conservation of this protein with many bacteria. 

The third protein, referred to as MAP2, was obtained from a gene which was cloned 
and sequenced by Mahan et al. (1994). The function of MAP2 is unknown; however, it was 
found to be a surface protein (Mahan, unpublished report) and may play a role in adhesion, 



33 
invasion, or pathogenicity of C. ruminantium. A recombinant form of MAP2 was prepared 
and was recognized by all sera tested from heartwater infected animals (Mahan et al, 1994), 
suggesting that MAP2 may be useful as an antigen in a serodiagnostic test. 

In order to develop a specific diagnostic test using MAP2, the protein must be 
examined for variability between different geographic isolates. Molecular mapping of the 
map2 gene was accomplished by cloning, restriction mapping and sequencing to identify 
variations among MAP2 in all isolates examined. In addition to determining whether this 
protein is either highly conserved or varied geographically, examination at the molecular level 
may be useful in determining the direction of the spread of disease, i.e. evolutionary 
movement of the organism. This theory was postulated by Reddy et al.{ 1 996) who suggested 
that the Antigua isolate (Antigua) and the Gardel isolate (Guadeloupe) originated from 
separate introductions of the tick to the Caribbean. This theory is supported by genetic 
variations discovered between the cuticular hydrocarbon compositions of A. variegatum from 
St. Lucia and Guadeloupe (Estrada-Pena et al, 1994). 

Cowdria ruminantium was isolated from animals and vectors from over twenty 
regions in sub-Saharan Africa, its neighboring islands, and the Caribbean. These isolates 
(material which has not been strictly defined after isolation by cloning [ Wassink et al., 1 990]), 
were shown to vary in their pathogenicity to livestock (Roussouw et al., 1990; Du Plessis et 
al., 1992) and mice (Wassink et al., 1986; Du Plessis et al., 1989; Wassink et al., 1990), and 
in their cross-protection against each other (Jongejan et al., 1988; Du Plessis et al., 1989; 
Jongejan, 1 99 1 ; Audu et al., 1 995). The selection of an antigen conserved among all isolates 



34 
regardless of pathogenicity would be ideal for the development of heartwater serodiagnostic 
tests for heartwater. 

Five isolates were examined because of their geographical location. Three isolates 
were of Zimbabwe origin, Crystal Springs (Byrom et al., 1991), Highway (Byrom et al., 
1 99 1 ) and Palm River (Byrom and Yunker, 1 990), one isolate each from Sudan in Africa and 
Antigua from the Caribbean, Um Banein (Jongejan et al., 1984) and Antigua (Birnie et al., 
1985), respectively. In this report, it was determined, on the basis of sequence data, that the 
map2 gene was conserved among these five isolates. 



35 
Materials and Methods 

Origin ofCowdria ruminantium Isolates 

Three isolates of C. ruminantium from Zimbabwe were used for these studies: Crystal 
Springs, Highway and Palm River (Byrom and Yunker, 1990); one isolate from Sudan, Um 
Banein (Jongejan et al., 1984); and the Antigua isolate from the Caribbean (Birnie et al., 
1985). Organisms, cultured in bovine aortic endothelial cells (Bezuidenhout et al, 1985), 
were harvested from the culture following the complete lysis of endothelial cells. Culture 
supernatants were centrifuged at 400 x g for 10 minutes to remove host debris, and the 
organisms in the supernatant were washed twice in phosphate-buffered saline by 
centrifugation at 30,000 x g for 30 min. DNA isolation for all isolates was accomplished at 
the University of Florida/USAID/SADC Heartwater Research Project in Causeway, 
Zimbabwe. The final DNA pellet was resuspended in saline EDTA (0.15 M NaCl, 0.1 M 
NajEDTA) (Mahan et al, 1994). 

Amplification of the map! Gene of Different Geographic Isolates 

Six primers (Table 1), designed from the flanking regions of the entire MAP-2 gene 
(open reading frame 1) of C. ruminantium clone pF5.2 (Figure 1) were synthesized at the 
Oligonucleotide Synthesis Laboratory (Interdisciplinary Center for Biotechnology Research; 
University of Florida, Gainesville). These primers were used in nine combinations (Table 2) 
to amplify map! gene of the Crystal Springs isolate of C. ruminantium. Briefly, target DNA 
(1 ng) was amplified in a mixture of 0.4 raM dNTPs, 0.5 uM (each) primer, 20 mM MgCl 2 , 



36 

100 mM KC1, 200 mM Tris-HCl (pH 8.2), 60 raM (NH 4 ) 2 S0 4 , 1% Triton X- 100, 100 ug/ml 
nuc lease-free bovine serum albumin, and 2.5 units of native Pfu DNA polymerase. The 
reaction was performed at 94°C for 5 min; 30 cycles of 93 °C for 1 min, 40°C for 1 min, and 
72 °C for 1.5 min; and a final extension step at 72 °C for 10 min. PCR samples with or 
without the Crystal Springs isolate DNA were used as positive and negative controls. The 
amplicons were analyzed by gel electrophoresis on a 0.8% agarose gel in IX TBE buffer (89 
mM Tris, 89 mM boric acid, 2 mM disodium EDTA). 

PCR samples were purified using the QIAquick Spin PCR purification kit (Qiagen, 
Inc., Chatsworth, CA) as described. The DNA was eluted in 50 /A 1 mM Tris-HCl, pH 8.3. 
The DNA concentrations were determined using a spectrophotometer at 260/280. DNA 
samples were digested with restriction enzymes Hindi, EcoRY, and Xbal and the appropriate 
bands confirmed using the reported Crystal Springs isolate map2 DNA (Genbank #g289922) 
determined by the map program of the Genetics Computer Group programs package (GCG, 
University of Wisconsin). All isolates, Highway, Palm River, Um Banein, and Antigua, were 
amplified with primers AB249 and AB25 1 and purified using the QIAquick PCR purification 
procedure. 

Cloning and Restriction Enzyme Analysis 

Amplicons were concentrated to 20 /il in a speed vac concentrator (Savant 
Instruments, Inc., Farmingdale, NY) and ligated to JTcoRV-digested pBluescript SK+ 
(Stratagene, La Jolla, CA) at 16°C in the presence of T4 DNA Ligase at an insert:vector 
molar ratio of 8 : 1 . Escherichia coli strain XL 1 -Blue cells were grown in L-broth containing 






37 

tetracycline (12.5 /Ug/ml). Cells were centrifuged at 5000 rpm for 5 min at 4 °C in a Jouan 
centrifuge, resuspended in 10 mM Tris-HCl (pH 7.6), 50 mM CaCl, and incubated on ice. 
Cells were centrifuged again at 5000 rpm under the same conditions and resuspended gently. 
The recombinant plasmid was used to transform competent E. coli XL 1 -Blue cells, and grown 
on LB agar plates in the presence of ampicillin (50 ug/ml), X-Gal(50 mg/ml) and IPTG (0.2 
mg/ml) (Sambrook et al., 1 989). White colonies were picked from the plates, inoculated into 
terrific broth (Tartof and Hobbs, 1987) containing ampicillin, and incubated overnight at 37°C 
with vigorous shaking. Plasmid DNA was extracted using the boiling prep method (Holmes 
and Quigley, 1981). DNA was reconstituted in TE buffer (pH 8.0) containing 20 Mg/ml 
DNase-free RNase and analyzed on a 0.8% agarose gel. Recombinant clones containing the 
map2 genes were digested with seven restriction enzymes (Accl, Hindi, EcoKV, EcoRl, 
Xbal, BamHl, and Hindlll) to compare their various sizes with those reported previously for 
the Crystal Springs isolate. The resulting restriction enzyme-digested DNA was analyzed on 
a 0.8% agarose gel. 

DNA Sequencing and Sequence Data Analysis 

The DNA insert in pBluescript SK(+) was sequenced from both double-stranded DNA 
using the dideoxy chain termination reactions using Sequenase (United States Biochemical), 
as recommended by the manufacturer. Briefly, DNA was denatured using 20 mM EDTA and 
1 N NaOH. The DNA was precipitated by incubation at -20 °C in the presence of 3 M 
sodium acetate, pH 5.4 and 100% ethanol followed by centrifugation. The DNA was dried 
in a speed vac concentrator after a wash with 70% ethanol. 



38 

In the presence of Sequenase reaction buffer (200 mM Tris-HCl, pH 7.5; 100 mM 
MgCl 2 ; 250 mM NaCl), the primer (10 ng//ul) was annealed to the DNA template by 
incubation at 37°C. The annealed DNA was incubated with DTT (100 mM), labeling mix 
(0.3 /zmdGTP, 0.3 //mdCTP, 0.3 fxM dTTP), dATP[ 35 S] (6.25 uCi), and Sequenase Version 
2.0 T7 DNA polymerase (26 units) at room temperature. The mixture was added to the 
appropriate dNTPs and incubated at 37 °C. The reaction was stopped using stop solution 
(95% formamide; 20 mM EDTA; 0.05% bromophenol blue; 0.05% xylene cyanol FF) and the 
samples were stored at -20 °C. 

The sequence gel was heated to 50 °C and the samples were heated to 75 °C and then 
loaded onto the gel. Short (1 .5 hr) and long runs (2.5 hr) were done and the gel was removed 
from the electrophoresis apparatus, transferred onto 3M paper (Whatman International Ltd, 
Maidstone, England), and dried in a gel vacuum dryer (Bio-Rad Laboratories, Melville, NY). 
The gel was exposed to X-ray film (Hyperfilm™ MP, Amersham Corporation, Arlington 
Heights, IL) and the sequence was recorded from the film. T3 and T7 plasmid-specific 
promoter primers were used in initial reactions and then new oligonucleotides were 
synthesized based on the sequences obtained ('primer walking'). Insert DNA was completely 
sequenced on both strands. 

The complete sequences of DNA were analyzed on the VAX system using the 
Genetics Computer Group programs package (University of Wisconsin). Comparisons were 
made using the Map program for restriction enzyme analysis and the Pretty and Gap programs 
for comparisons between the different isolates. All DNA sequences were translated in six 
frames into polypeptides using the Map program of the GCG package. DNA sequences 



39 

translating into open reading frames were selected and compared with the reported Crystal 
Springs isolate reported previously. Comparisons were made of similarities and identities 
between the different isolates using the Translate, Pileup, and Pretty programs of GCG 
package . 






Southern Blot Analysis 

DNA probe labeling and probe hybridization were done according to instructions by 
the manufacturer of the DIG/Genius™ System 1 kit (Boehringer-Mannheim). Amplified 
Crystal Springs DNA was incubated overnight at 37 °C in IX hexanucleotide mix (6.25 A260 
units/ml random hexanucleotides, 50 mM Tris-HCl, 10 mM MgCl 2 , 0.1 mM dithioerythritol, 
and 0.2 mg/ml BSA; pH 7.2), 1 X dNTP labeling mix (0. 1 mM dATP, 0. 1 mM dCTP, 0. 1 mM 
dGTP, 65 mM dTTP, 35 /xM DIG-dUTP; pH 6.5), and 2 units/^l DNA polymerase I (Klenow 
enzyme, large fragment), labeling grade. Disodium EDTA (200 mM, pH 8.0) was added to 
the tube to terminate the reaction and glycogen solution (20 mg/ml) was added. The labeled 
DNA was precipitated with 0.1 volume of LiCl and 3 volumes of 100% ethanol (-20°C) and 
incubated at -70°C for 30 min. The solution was centrifuged at 13,000 x g for 15 min to 
pellet DNA, washed with 70% ethanol by centrifugation for 5 min, dried in a speed vac 
concentrator and resuspended in 50 /ul of TE/SDS buffer. 

Gels containing target DNA were submerged in denaturing solution (0.5 N NaOH, 
1 .5 M NaCl) while shaking for 30 minutes at room temperature. Submerged gels were then 
neutralized in 1 .0 M Tris-HCl, pH 8.0; 1 .5 M NaCl for 30 min. DNA was blotted overnight 
to nylon membrane by capillary transfer to the membrane using 1 OX SSC buffer ( 1 .5 M NaCl, 



40 
150 mM sodium citrate; pH 7.0). DNA was fixed to the membrane either by UV fixation in 
the Stratalinker or by incubation for one hour in an 80° C oven. 

The membrane was placed in a rolling bottle with prehybridization solution [5X SSC, 
1.0% (w/v) Blocking reagent for nucleic acid hybridization, 0. 1% N-lauroylsarcosine, 0.02% 
sodium dodecyl sulfate (SDS)] and incubated for two hours. The DNA probe was heated in 
a boiling water bath for 1 min to denature DNA, then diluted into the prehybridization 
solution and added to the membrane for overnight incubation. The membranes were washed 
three times with 2X SSC, 0.1% SDS for 5 min at room temperature and three times with 0.5 
X SSC, 0.1% SDS for 15 min at 50°C with heterologous DNA and 65°C with homologous 
DNA. 

After washes, the membrane was equilibrated in filtered Genius buffer 1 (100 mM 
Tris-HCl, 1 50 mM NaCl; pH 7.5) for 1 min, and blocked with Genius buffer 2 (2% Blocking 
reagent in Genius buffer 1) for 60 min. After Genius buffer 1 was discarded, the membrane 
was incubated for 30 min in antibody solution (anti-digoxigenin [Fab] conjugated to alkaline 
phosphatase; 1:10,000 in Genius buffer 2). The antibody solution was discarded and the 
membrane was washed three times for 1 5 minutes each with Genius buffer 1 . The membrane 
was equilibrated with Genius buffer 3 ( 1 00 mM Tris-HCl, 1 00 mM NaCl, 50 mM MgCl 2 ; pH 
9.5) and placed between two sheets of 3M transparency film. The top sheet was lifted and 
0.5 ml of diluted Lumigen PPD (1:100) was added to the membrane surface, excess liquid 
was removed and the covered membrane was exposed at room temperature to Hyperfilm™. 



41 












Table 1. Primers designed based on the reported sequence of pF5.2 



PRIMER LABEL 


PRIMER (5'-3') SEOUENCE 


AB247 


TAAATAACGAAACTCCTCTA 


AB248 


TAACTAAACAATACTAACCA 


AB249 


AAACTCTAATTTTATACA 


AB250 


CAAGCAGTAAAAATAAGAC 


AB251 


AAAATAAGACTAAAAGAAAC 


AB252 


TCTATTTAATTAAGTATTAAATTA 





































42 








1 


aaataatata 


gaaactacag 


cacaggtaat 


tagtaatctt 


atatcacaag 


ettgecaata 


61 


tataacttcc 


gtaaaaaata 


tcaaaatatc 


agatccaact 


tgatatgata 


actatctaac 


121 


tatagttttg 


ataacttata 


aactcttact 


aaaataccaa 


taggtaacaa 


taattaattt 


181 


taaagcttta 


atgcctatat 


aatataaaag 


caagtaaagt 


aattttttag 


ttattcattt 


241 


aatacattat 


gcaatttcaa 


aacttaccat 


tatgttacat 


acctatatta 


attattaagt 


301 


ttagtaatta 


attatatgaa 


ttataattat 


actatataaa 


tatgtaatat 


ttaacttaat 


361 


aaagttcttt 


catattacat 


aaatattgat 


agataaaaaa 


aatttaagat 


tattaegtag 


421 


taaagcatct 


ataaaacata 


cttaaaacaa 


gtagaactat 


tctcaagtat 


catacctatc 


481 


taactctcac 


ataaatatca 


accaatatat 


taacaaattc 


attacaaaat 


ectataatge 


541 


aatatattaa 


acaacatgca 


tttaagaaaa 


aaggtataag 


ctatctcata 


gtgattatta 


601 


gtattacaat 


tataaataat 


aaacattagt 


acaaattaac 


ttttcaagaa 


ttcaatacaa 


661 


agtaccaaca 


tctatattaa 


ataattactt 


gaagaaaaat 


ttataagtac 


atactattct 


721 


acataacatt 


agtataaaaa 


aacatcaatg 


catattccag 


aaatctacta 


caaaatcaaa 


781 


tacataaata 


aagacaatta 
AB247 


aaacatatta 


tactaacata 


tataaataat 


aagctattta 


841 


attaatttaT AAATAACGAA ACTCCTCTAc 


agcattttta 


gaataatacc 


tactacacta 


901 


ggaattattt 


acttgctata 


ttttatgeta 


gtcattgtaa 


taatacatat 


acaatagatt 


961 


cataatcaac 


tctgaaatgt 


aattactcat 


acactaaaaa 


tatcattttt 


tatagegtaa 


1021 


gtatatacaa 


ttttactaca 
AB248 -» 


taactaaaag 


aaaaaacata 


gaagtttaaa 


ttttattTAA 


1081 


CTAAACAATA 


CTAACCAaaa 


tatagaaatt 


ttagattcac 


aatttgeata 


tttaaatact 


1141 


acaaagataa 


aacatactat 


aaaaattttt 


agtaacttga 


cataacacaa 


cattgttata 










AB249 -» map2 gene -> 


1201 
1261 


gcatatatga 
AGGCTATCAA 


tacgtgtttt 
GTTTATACTT 


tataaaAAAC 


TCTAATTTTA 


TACAATGGAG 


CACATCATGA 
TTGGGATATT 


AATCTATGTT 


TACTATTTGC 


AGCAATTTTT 


1321 


CTTACATAAC 


AAAACAAGGT 


ATATTCCAAC 


CAAAATTACA 


CGACTCTCCT 


GATGTTAATA 


1381 


TATCGAACAA 


AGCGGATATA 


AATACTAGCT 


TTAGCTTAAT 


TAATCAGGAT 


GGTATTACGA 


1441 


TATCTAGTAA 


AGACTTCCTT 


GGAAAACATA 


TGTTAGTCCT 


TTTTGGGTTT 


TCTTCTTGTA 


1501 


AAACTATTTG 


CCCCATGGAA 


CTAGGGTTAG 


CATCCACAAT 


TCTAGATCAA 


CTTGGCAACG 


1561 


AATCTGACAA 


GTTACAAGTA 


GTCTTTATAA 


CTATTGATCC 


AACAAAAGAT 


ACTGTAGAAA 


1621 


CACTAAAAGA 


GTTTCACAAA 


AATTTTGACT 


CACGGATTCA 


AATGTTAACA 


GGAAACATTG 


1681 


AAGCTATTAA 


TCAAATAGTA 


CAAGGGTACA 


AAGTATATGT 


AGGTCAGCCA 


GACAATGATA 


1741 


ACCAAATTAA 


CCATTCTGGA 


ATAATGTATA 


TTGTAGACAA 


GAAAGGAGAA 


TATTTAACAC 


1801 


ATTTTGTACC 


AGATTTAAAG 

* 


TCAAAAGAGC 
<-AB252 


CTCAAGTGGA 


TAAATTACTT 


TCTTTAATTA 


1861 


AGCAGTATCT 


TTAATTTAAT 


ACTTAATTAA ATAGAataat 


acagactttt 
1 *■ 


atatagaatc 
AB250 






<-AB25 


1921 


taacctttag 


gatatatatc 


taatgaagaa 


GTTTCTTTTA 


GTCTTATTTT TACTGCTTGt 


1981 


aatgttaccc 


aaagattcta 


atgeggaaca 


tatacatgtt 


gttggatcat 


ctacagcatt 


2041 


tccatttatc 


gcagcaatag 


cagaagaatt 


tgggaggttt 


tcagattatg 


gaacacctat 


2101 


aatagagtct 


gtggggagtg 


gtatgggttt 


tagtatgttt 


tgtcaaagtg 


tagaaaacag 


2161 


tacgccagat 


atagctatgt 


catctegtaa 


gataaaggat 


gcagaggtag 


aattatgtaa 


2221 


aagtaatgac 


gttcatgaca 


ttattgaaat 


cattatagga 


tatgatggta 


ttgttattgc 


2281 


aaactctaac 


aatagcaata 


agcttgattt 


tacaaaaaaa 


gatctattca 


aagctttaag 


2341 


caagtatgca 


acgtcagaag 


aatatacaca 


tagtatacca 


gtaaatgatt 


ttaagtattg 


2401 


gtcagaaatt 


aataataggt 


tccccaatat 


tgatattgaa 


gtttaeggae 


catacaaaaa 


2461 


cacaggtact 


tataatatac 


taatcgaaga 


aataatgcag 


gattcttgta 


tgaatcataa 


2521 


aaatttcatt 


gaagtatacc 


cagacttaaa 


aaaaagacaa 


cacgcatgca 


gtatgatccg 


2581 


caatgatggc 


aagtacattg 


aagttgcagc 


taatgaaaac 


attattatac 


aaaaaattgc 


2641 


aaaaaataat 


gctgcttttg 


gtatttttag 


ttttagcttt 


ttaatacaga 


atcaagataa 


2701 


aatacatgga 


aataaaattg 


caggtgtgga 


acctacatat 


gaaactattt 


cctctggaaa 


2761 


atatatttta 


tea 










Figure 1 . 


DNA sequence of pF5.2 plasmid insert DNA. The map2 


gene(1245bptol871bp) 


is shown 


(capitalized). 


The underlined and/or italicized areas 5' and 3' to the map! gene 


represent PCR primers 


and the reverse complement of PCR primers developed, respectively. 



43 



Table 2. Primer Combinations and Projected Product Size 



PRIMERS 


AB247 


AB248 


AB249 


AB250 


1130* 


902 


752 


AB251 


1120 


892 


742 


AB252 


1022 


794 


644 


* Projected number of 


?ases 










44 
Results 

Cloning and Restriction Enzyme Analysis of the MAP2 Genes 

Six different primer combinations were used to amplify Crystal Springs DNA (Figure 
2) yielding bands approximately 1.13 kb, 1.12 kb, 0.9 kb, 0.9 kb, 0.75 kb, and 0.74 kb, 
respectively. Primer AB252 did not amplify DNA under the conditions used. Primers AB249 
and AB25 1 were used to amplify the map! gene of all isolates of C. ruminantiwn. The 
amplified products of approximately 0.74 kb were identified (Figure 3). Amplification of 
map! gene products was confirmed by Southern hybridization with a DNA probe derived 
from the map! gene of the Crystal Springs isolate (Figure 4). Amplicons were ligated into 
the EcoRV site of pBluescript SK+ and transformed into E. coli strain XL1 Blue. 

Restriction enzyme analysis of the map2 genes demonstrated similarities between Palm 
River, Um Banein, and Antigua and similarities between Crystal Springs and Highway (Figure 
5). That is, EcoRV, Xbal, and Hindi restriction sites were found in all isolates analyzed. The 
AccI restriction site was observed in Crystal Springs reported previously and the Highway 
isolate, and was absent from all other isolates. Likewise, Palm River, Um Banein, and 
Antigua isolates had identical restriction enzyme maps and contained an additional Hindi site. 



Sequence Analysis of MAP2 Genes 

The AB249 and AB251 primer paired-amplified DNAs of the four Cowdria isolates 
were sequenced and compared with the Crystal Springs isolate MAP2 sequences (Genbank 



45 
#g289922) at both the nucleotide (Figure 6 and Table 3) and amino acid (Figure 7 and Table 
4) levels. At both the nucleotide and amino acid levels, Highway and Crystal Springs MAP2 
sequences were identical. Palm River, Um Banein, and Antigua differed at nucleotide 
positions 111, 192, 319, 465, 483, 534, 553, and 594 (Table 3). Um Banein differed at 
position 150 from all isolates. Antigua differed at position 323 compared to other isolates. 
Two of these changes resulted in the gain or loss of restriction enzyme sites AccI [5'- 
GTAGAC-3'] and Hindi (5'-GTC AAC-3'). In Palm River, Um Banein, and Antigua isolates, 
a cytosine (C) was replaced with a thymine (T) resulting in the loss of the AccI site. The 
additional Hindi site observed in the Palm River, Um Banein, and Antigua isolates was not 
present in Highway and Crystal Springs isolates due to a substitution of guanine (G) for the 
second adenine (A) in the additional Hindi site of the map2 gene. Of these ten nucleotide 
differences, seven represent silent mutations, but substitutions at positions 319, 323, and 553 
lead to three amino acid substitutions (Table 4). Serine (a.a. 107) and threonine (a.a. 185) 
of Crystal Springs and Highway were both substituted by alanine in Palm River, Um Banein, 
and Antigua. Antigua differed from all others at amino acid 108 where a glycine has been 
substituted for an aspartic acid. 

Similarity between nucleotide sequences ranged from 98.56% to 1 00% translating into 
0% to 1 .44% variation in the predicted protein sequences, which illustrates the conservation 
of this protein (Tables 5 and 6). 



46 






1 23456789 



1636- 
1018- 



517- 
396- 




Figure 2. Analysis of PCR products of the Highway isolate of Cowdria ruminantium using 
various primer combinations. AB247/AB250 (lane 1), AB247/AB251 (lane 2), 
AB247/AB252 (lane 3), AB248/AB250 (lane 4), AB248/AB251 (lane 5), AB248/AB252 
(lane 6), AB249/AB250 (lane 7), AB249/AB251 (lane 8), AB249/AB252 (lane 9). 






47 




Figure 3. Analysis of PCR products of the five isolates of Cowdria ruminantium using 
primers AB249 and AB251. PCR amplicons of Antigua (lane 1), Highway (lane 2), Palm 
River (lane 3), Um Banein (lane 4), and Crystal Springs (lane 5). 












48 



12 3 4 



2036- 
1636- 



1018- 



517- 




Figure 4. Southern blot analysis of PCR products of the five isolates of Cowdria 
ruminantium using primers AB249 and AB251. Antigua (lane 1), Highway (lane 2), Palm 
River (lane 3), Um Banein (lane 4), and Crystal Springs (lane 5). 



49 






RESTRICTION ENZYME ANALYSIS OF MAP2 GENES 



0.2 kb 
< >■ 



a y h a 



Crystal Springs - pF5.2 (2.7 kb long) 



Highway 



Palm River 



Um Banein 



Antigua 



Ev X 


H A 


Ev * 


H H 


Ev X 


H H 


Ev X 


h h 



Enzymes used for mapping: 

A Accl; B, BamHI; El, EcoRI; Ev, EcoRV; 
H, Hindi; Hd, Hindlll; X, Xbal 



Figure 5. Restriction maps of the map! genes from Cowdria ruminantium isolates. Maps 
are drawn left to right, 5' to 3' with respect to the MAP2 coding sequence. Restriction 
enzymes used for mapping are EcoRV (Ev), Hindi (H), Xbal (X), Acd (A), BamHI, EcoRI, 
and Hindlll (Hd). The restriction map of the Crystal Springs isolate map2 gene is presented 
for comparison. 



50 



l 

C.Springs ATGGAGCACA TCATGAAGGC TATCAAGTTT ATACTTAATC TATGTTTACT 

Highway 

PalmRiver 

UmBanein 

Antigua 

51 
C.Springs ATTTGCAGCA ATTTTTTTGG GATATTCTTA CATAACAAAA CAAGGTATAT 

Highway 

PalmRiver 

UmBanein 

Antigua 

101 
C.Springs TCCAACCAAA ATTACACGAC TCTCCTGATG TTAATATATC GAACAAAGCG 

Highway 

PalmRiver G 

UmBanein G T 

Antigua G 

151 
C.Springs GATATAAATA CTAGCTTTAG CTTAATTAAT CAGGATGGTA TTACGATATC 

Highway 

PalmRiver C 

UmBanein C 

Antigua C 

201 
C.Springs TAGTAAAGAC TTCCTTGGAA AACATATGTT AGTCCTTTTT GGGTTTTCTT 

Highway 

PalmRiver 

UmBanein 

Antigua 

251 
C.Springs CTTGTAAAAC TATTTGCCCC ATGGAACTAG GGTTAGCATC CACAATTCTA 

Highway 

PalmRiver 

UmBanein 

Antigua 

Figure 6. Comparison of the MAP2 coding sequences at the nucleotide level. The MAP2 
coding sequences of the four isolates were determined for both strands and were aligned with 
the MAP2 sequence from the Crystal Springs isolate using the Genetics Computer Group 
programs. The complete nucleotide sequence from the Crystal Springs isolate is presented. 
The sequences for other isolates are presented only when they differed from the Crystal 
Springs sequence. A dot indicates identity with the Crystal Springs sequences. Underlined 
sequences represent restriction enzyme sites altered by nucleotide substitutions. 



51 



C.Springs 

Highway 

PalmRiver 

UmBanein 

Antigua 



301 

GATCAACTTG GCAACGAATC TGACAAGTTA CAAGTAGTCT TTATAACTAT 



.G. 
,G. 

.G. 



C.Springs 

Highway 

PalmRiver 

UmBanein 

Antigua 



351 

TGATCCAACA AAAGATACTG TAGAAACACT AAAAGAGTTT CACAAAAATT 



C.Springs 

Highway 

PalmRiver 

UmBanein 

Antigua 



401 

TTGACTCACG GATTCAAATG TTAACAGGAA ACATTGAAGC TATTAATCAA 



C.Springs 

Highway 

PalmRiver 

UmBanein 

Antigua 



451 Hindi 

ATAGTACAAG GGTACAAAGT ATATGTAGGT CAGCCAGACA ATGATAACCA 



T 


A 


T 


A 







C. Springs 

Highway 

PalmRiver 

UmBanein 

Antigua 



501 AccI 

AATTAACCAT TCTGGAATAA TGTATATT GT AGAC AAGAAA GGAGAATATT 



C.Springs 

Highway 

PalmRiver 

UmBanein 

Antigua 



551 

TAACACATTT TGTACCAGAT TTAAAGTCAA AAGAGCCTCA AGTGGATAAA 



.G. 

. G. 
.G. 



.A. 
.A. 
.A. 



C.Springs 

Highway 

PalmRiver 

UmBanein 

Antigua 



601 

TTACTTTCTT TAATTAAGCA GTATCTT 



Figure 6.(continued) 






52 



Table 3. Comparison of the MAP2 coding sequences at the nucleotide level. Capitalized 
letters represent changes that affect the coding sequence at the amino acid level. 





NUCLEOTIDE POSITION 


ISOLATE 


111 


150 


192 


319 


323 


465 


483 


534 


553 


594 


C. SPRINGS 


a 


g 


t 


T 


A 


c 


g 


c 


A 


g 


HIGHWAY 


a 


g 


t 


T 


A 


c 


g 


c 


A 


g 


PALM RIVER 


9 


g 


c 


G 


A 


t 


a 


t 


G 


a 


UM BANE IN 


9 


t 


c 


G 


A 


t 


a 


t 


G 


a 


ANTIGUA 


g 


g 


c 


G 


G 


t 


a 


t 


G 


a 



C. Springs = Crystal Springs 



53 









1 * 50 

C.Springs MEHIMKAIKF ILNLCLLFAA IFLGYSYITK QGIFQPKLHD SPDVNISNKA 

Highway 

Palmrivr 

Umbanein 

Antigua 

51 100 

C.Springs DINTSFSLIN QDGITISSKD FLGKHMLVLF GFSSCKTICP MELGLASTIL 

Highway 

Palmrivr 

Umbanein 

Antigua 

101 150 

C.Springs DQLGNESDKL QVVFITIDPT KDTVETLKEF HKNFDSRIQM LTGNIEAINQ 

Highway 

Palmrivr A 

Umbanein A 

Antigua AG 

151 200 

C.Springs IVQGYKVYVG QPDNDNQINH SGIMYIVDKK GEYLTHFVPD LKSKEPQVDK 

Highway 

Palmrivr A 

Umbanein A 

Antigua A 

201 
C.Springs LLSLIKQYL* 

Highway 

Palmrivr 

Umbanein 

Antigua 

Figure 7. Comparison of the MAP2 coding sequences at the amino acid level. The nucleotide 
sequences for all five isolates were translated. The complete sequence for the Crystal Springs 
isolate is presented. The sequences for other isolates are presented only when they differed 
from the Crystal Springs sequence. A dot indicates identity with the Crystal Springs 
sequence. The ** indicates the first amino acid, alanine, predicted to be the N-terminus of the 
mature protein. 






54 















Table 4. MAP2 Amino Acid Sequence Changes between Different Isolates of Cowdria 
ruminantium 



AMINO ACID POSITION 


ISOLATE 


107 


108 


185 


CRYSTAL SPRINGS 


Ser 


Asp 


Thr 


HIGHWAY 


Ser 


Asp 


Thr 


PALM RIVER 


Ala 


Asp 


Ala 


UM BANEIN 


Ala 


Asp 


Ala 


ANTIGUA 


Ala 


Gly 


Ala 



55 



Table 5. Percent Identities Between the MAP2 Coding Sequences of Isolates ofCowdria 
ruminantium 



Isolates 


C . Springs 


Highway 


Palm River 


Urn Banien 


Antigua 


C . Springs 


- 


100.00% 


98.72% 


98.56% 


98.56% 


Highway 


- 


- 


98.72% 


98.56% 


98.56% 


Palm River 


- 


- 


- 


99.84% 


99.84% 


Urn Banein 


- 


- 


- 


- 


99.68% 


Antigua 


- 


- 


- 


- 


- 









56 






Table 6. Percent Identity between MAP2 Amino Acid Sequences of Isolates of Cowdria 
ruminantium 



Isolates 


C . Springs 


Highway 


Palm River 


Urn Banien 


Antigua 


C . Springs 


100.00% 


100.00% 


99.04% 


99.04% 


98.56% 


Highway 


- 


100.00% 


99.04% 


99.04% 


98.56% 


Palm River 


- 


- 


100.00% 


100.00% 


99.52% 


Urn Banein 


- 


- 


- 


100.00% 


99.52% 


Antigua 


- 


- 


- 


- 


100.00% 



57 
Discussion 

The map! sequence was highly conserved among the five isolates with only 
conservative substitutions detected at three positions (a variability between 0% to 1 .44% in 
the predicted protein). This differed from the sequenced MAPI of several isolates which was 
found to contain three hypervariable regions, between and 14% variability at the nucleotide 
level, and 0.8 and 1 0.0% variability in the predicted protein (Reddy etal, 1996). MAPI also 
had several insertions and deletions resulting in products of different molecular weights 
ranging from 27.64 kDa (Antigua isolate) to 28.82 kDa (Nyatsanga isolate) (Reddy et ah, 
1996). Finally, MAPI may be a member of a multi-gene family (Reddy et ah, unpublished) 
and subject to variation resulting from recombination events. MAP2, on the other hand, had 
similar molecular weights in all isolates. 

The ten substitutions between the different isolates represented only three amino acid 
changes. As far as geographic correlation between the different isolates, MAP2 was identical 
between Crystal Springs and Highway isolates. However, it was important to note that these 
isolates were collected from neighboring farms. The third Zimbabwe isolate. Palm River, 
although geographically close to Crystal Springs and are transmitted by the same vector A. 
hebraeum, has a more similar amino acid sequence to Um Banein and Antigua. The Palm 
River isolate differed from Crystal Springs and Highway isolates at position 107, where the 
neutral, hydrophobic amino acid alanine was substituted for the neutral polar amino acid 
serine. Palm River was identical at the amino acid level to the Um Banein isolate. The 
Antigua isolate was similar to Um Banein and Palm River, except at amino acid 108 where 
the neutral, polar amino acid glycine has been substituted for the amino acid aspartic acid. 









58 
These changes had little effect on predicted antigenic determinants (Hopp and Woods, 1981 ) 
of Um Banein, Antigua, and Palm River; however, changes did affect one potential antigenic 
site (Table 7) of Highway and Crystal Springs. Flexibility regions (Flexpro Program of 
PC/Gene) were similar for all of the isolates (Table 8). 

These results demonstrated that the MAP2 was conserved among different isolates 
of C. ruminantium. The MAP2 antigen was recognized by infection sera from all sheep, 
goats, and cattle tested, indicating that it was an excellent candidate for diagnosis. A 55.5% 
identity between MAP2 and the coding DNA sequence for major surface protein 5 (Visser 
et al., 1992) of Anaplasma marginale was reported (Mahan et al., 1994). A competitive 
ELISA using infection antisera to inhibit the reaction between recombinant MSP5 and an anti- 
MSP5 monoclonal antibody specifically was used to diagnose cattle infected with A. 
marginale for as long as six years post-infection (Knowles et al, 1996). The similarity 
between MSP5 and MAP2, the conservation of MAP2 antigenicity between isolates and for 
different animal species (Mahan et al, 1 994), and the MAP2 sequence conservation reported 
here support the theory that MAP2 may be useful as an antigen in serodiagnosis of 
heartwater. Based on these data, MAP2 is a strong immunoassay candidate and further 
investigation is warranted to determine whether MAP2 is a good candidate antigen to be used 
for serodiagnosis of heartwater. 



59 






Table 7. Prediction of Antigenic Determinants 





Il 

Highest Points of Hydro philicity 


Isolate 


1 


2 


3 


Crystal Springs 


Val- Asp-Lys-Lys-G ly-G lu 


Asp-Leu-Lys-Ser-Lys-Glu 


Gly-Asn-Glu-Ser-Asp-Lys 


Highway 


Val-Asp-Lys-Lys-Gly-Glu 


Asp-Leu-Lys-Ser-Lys-Glu 


Gly-Asn-Glu-Ser-Asp-Lys 


Palm River 


Val-Asp-Lys-Lys-Gly-Glu 


Asp-Leu-Lys-Ser-Lys-Glu 


Lys-Ser-Lys-Glu-Pro-GIn 


Um Banein 


Val-Asp-Lys-Lys-Gly-Glu 


Asp-Leu-Lys-Ser-Lys-Glu 


Lys-Ser-Lys-Glu-Pro-Gln 


Antigua 


Val-Asp-Lys-Lys-Gly-Glu 


Asp-Leu-Lys-Ser-Lys-Glu 


Lys-Ser-Lys-Glu-Pro-GIn 



*Calculations based on the method used by Hopp and Woods (1981). The average group 
length is 6 amino acids. Sequences identical to Crystal Springs isolate are bold. 



60 



Table 8. Position and Sequence of Flexible Segments* 



No. 






Isolate 






Crystal Springs 


Highway 


Palm River 


Um Banein 


Antigua 


1 


DLKSKEP 


DLKSKEP 


DLKSKEP 


DLKSKEP 


DLKSKEP 


2 


GQPDNDNE 


GQPDNDNE 


GQPDNDNE 


GQPDNDNE 


GQPDNDNE 


3 


VDKKGEY 


VDKKGEY 


VDKKGEY 


VDKKGEY 


VDKKGEY 


4 


LHDSPDV 


LHDSPDV 


LHDSPDV 


LHDSPDV 


LHDSPDV 


5 


TISSKDF 


TISSKDF 


TISSKDF 


TISSKDF 


TISSKDF 


6 


IDPTKDT 


IDPTKDT 


IDPTKDT 


IDPTKDT 


IDPTKDT 


7 


GNESDKL 


GNESDKL 


GNEADKL 


GNEADKL 


LGNEAGK 


8 


NISNKAD 


NISNKAD 


NISNKAD 


NISNKAD 


NISNKAD 


9 


KNFDSRI 


KNFDSRI 


KNFDSRI 


KNFDSRI 


KNFDSRI 


10 


ITKQGIF 


ITKQGIF 


ITKQGIF 


ITKQGIF 


ITKQGIF 



* 10 highest peaks of flexibility in the complete sequence. Calculations based on the 
FLEXPRO program of PCGENE. Underlined regions are flexibility sites that may vary in 
their amino acid composition, but are located at similar regions of their respective proteins. 






CHAPTER 4 

IMMUNOASSAYS USING MAP2 TO IDENTIFY ANTIBODIES TO COWDRIA 

RUMINANTIUM IN THE SERA OF INFECTED ANIMALS 



Introduction 

Development of a serodiagnostic test specific for detection of animals infected with 
Cowdria ruminantium is needed for use in endemic and heartwater-free areas of the world. 
Detection of specific antibodies in the blood of infected animals is essential for determining 
the heartwater status of an animal. Two immune responses, humoral and cell-mediated, may 
be triggered when an animal has been invaded by an infectious agent, in this case, C. 
ruminantium. The parasite is present in the blood during the initial infection and after 
endothelial cell destruction and release of elementary bodies. During these times, antibodies 
are produced against the parasite, thus initiating the destruction of the organism by various 
immunological mechanisms (i.e. complement cascade, opsonization, antibody-dependent cell- 
mediated cytotoxicity). It is the presence of these antibodies (specific for various epitopes 
on the surface of the organism) that may be used for diagnosis of the disease. While the 
presence of antibodies does not directly reflect the presence of the disease agent, antibody 
detection tests are a useful adjunct to PCR assays which detect the organism directly (see 
literature review). 

The development of an indirect or competitive enzyme-linked immunosorbent assay 
(ELISA) for the diagnosis of C. ruminantium is needed to screen animals imported into the 

61 



62 

United States, as well as to monitor the spread of the disease in the Caribbean and Africa. 
Many tests including indirect fluorescent antibody assays, immunoblots, and ELISAs have 
been used in the detection of antibodies against C. ruminantium using either cultured 
organisms or organisms isolated from infected animals or ticks as the antigen (see literature 
review). This can be time-consuming and expensive and requires full-time personnel and 
necessary equipment and solutions. In addition, cross-reactivity has been observed with 
species of Ehrlichia (Jongejan et al, 1993; Matthewman et al., 1994; Kelly et al., 1994), 
which may be avoided in development of a diagnostic based on recombinant proteins or 
synthetic truncated analogs. 

Development of a serodiagnostic test for heartwater has been hindered by cross- 
reactivity and the variability of target proteins among various C. ruminantium isolates 
(Mahan, 1995). Major antigenic protein 1 (MAPI), a major structural protein of C 
ruminantium (Mahan et al., 1993), was determined to be conserved antigenically among 
various isolates of C. ruminantium (van Vliet et al., 1994). MAPI was developed into a 
competitive ELISA (Jongejan et al., 1 99 1 ) and used in surveys on animals in Africa (Jongejan 
and Thielemans, 1989) and in the Caribbean (Muller Kobold et al., 1992). However, Mahan 
et al (1993) demonstrated that the MAPI also cross-reacted with an unknown organism 
because testing of animals from heartwater-free (absence of both the vector and the disease) 
regions of Zimbabwe resulted in false positive reactions. This cross-reaction was thought to 
be due to the presence of an organism belonging to the family Rickettsiaceae. Sera from dogs 
experimentally infected with Ehrlichia canis recognized MAP 1 in Western blots (Kelly et al., 
1994). In addition, sequence analysis of MSP2 and MSP4 of Anaplasma marginale, 






63 

determined to be a close relative of C. ruminantium using 16S rDNA analysis, revealed highly 
significant homology with the C. ruminantium MAPI (Palmer et al, 1994; van Vliet et al. 
1994). Also, sequence and size variability of MAPI between different isolates of C. 
ruminantium and evidence that MAPI is a member of a multi-gene family were reported 
(Reddy et al., 1 996). Reddy et al. (manuscript submitted) reported that variability of MAP 1 
may be possibly due to genetic recombination. 

The MAP2 of C. ruminantium was determined to be highly conserved among 
geographic isolates based on serologic (Mahan et al, 1994) and molecular studies (Chapter 
3). MAP2 was developed into a recombinant protein which reacts with sera from 
heartwater- infected animals in Western blots (Mahan et al, 1994). In addition, MAP2 is a 
homolog of MSP5 of A. marginale which has been used successfully for development of an 
ELISA (Knowles et al, 1996). Although MAP2 and MSP5 are similar proteins, sufficient 
sequence differences exist to suggest that MAP2 may be useful in immunoassays that would 
be specific for the detection of C. ruminantium-'mfected animals. Sera to A. marginale- 
infected cattle did not react with the Palm River or Ball3 isolates of C. ruminantium (Semu 
et al, 1992). 



64 
Materials and Methods 

Cowdria ruminantium Recombinant MAP2 Production and Purification 

Nucleotide sequencing of the insert DNA in plasmid pF5.2 demonstrated that 627 bp 
of a 2773 bp cloned DNA insert encoded a protein with an approximate size of 21 kilodaltons 
(Mahan et al, 1994). The 627 base pair open reading frame (ORF) was subcloned into the 
expression vector pFLAG (International Biotechnologies, Inc., New Haven, CT) and 
transformed into Escherichia coli for expression of recombinant protein. 

An E. coli colony expressing MAP2 was selected and expanded in L-broth (1% 
tryptone, 0.5% yeast extract, 1% NaCl), induced with 0.1 mM isopropyl 0-D- 
thiogalactopyranoside (IPTG), and purified by monoclonal antibody affinity chromatography. 
Cultures were centrifiiged at 5,000 rpm for 20 minutes and the supernatant discarded. Eight 
milliliters of IX phosphate-buffered saline (PBS; 0.01 M NaH 2 P0 4 , 0.15 M NaCl), pH 7.4, 
were added and the sediment was re-suspended and frozen. Sediments were quick-thawed 
and sonicated on ice four times at 30 seconds each with 15-second waits between bursts. 
Sediments were centrifiiged at 4°C for 45 min at 19,500 rpm. Supernatants were filtered 
through glass pre-filter, 5.0 /urn PVDF, and 0.65 /um cellulose acetate filters using the Sterifil 
Aseptic System (Millipore Corporation, Bedford, MA). 

Anti-FLAG gel beads were added to the filtered supernatant and incubated for 30 
minutes at 4°C or on ice swirling gently. Beads were collected in the Millipore device using 
a 5.0 /^m PVDF filter. The beads were washed three times with cold IX PBS containing 1 .0 
mM CaCl 2 . Protein was eluted from the beads using IX PBS containing 2.0 mM 






65 

ethylenediaminetetraaceticacid(EDTA). Eluate was dialyzed three times in IX PBS. Protein 
concentration, size, and purity were determined on a 12% acrylamide gel. The antigenicity 
of the protein was determined using an indirect ELISA and hyperimmune serum from C. 
ruminantium-'mfected sheep. 

Antisera 

Positive sera were collected from sheep and cattle that had been born and reared under 
tick-free conditions and experimentally infected with an isolate of C. ruminantium. False 
positive sera were obtained from cattle and sheep born and raised in regions of Zimbabwe that 
were Amblyomma- and heartwater-free. Negative sera were obtained from sheep and cattle 
born and reared under tick-free conditions in Zimbabwe. The sera used for these studies are 
listed in Table 9. 

MAP2 Coating Concentration 

The optimum amount of recombinant MAP2 was determined by coating NUNC 
Maxisorp ELISA plates with 50 ul of the following protein concentrations: 8 ug/ml, 4 ug/ml, 
2 ug/ml, 1 ug/ml, 0.5 ug/ml, 0.25 ug/ml, 0.125 ug/ml, and 0.0625 ug/ml. Test sera were 
obtained from BALB/C mice hyperimmunized with recombinant MAP2. Normal BALB/C 
mouse sera were used as a control. 



66 
Indirect ELISA 

NUNC Maxisorp ELISA plates were coated using isolated recombinant MAP2 in IX 
phosphate buffer saline (IX PBS), 0. 14 M NaCl, 20 mM N^HPO^ 3 mM KH 2 P0 4 , pH 7.2, 
containing 0.02% sodium azide (IX PBS/azide) at 50 (A per well and incubated overnight at 
4°C. After five washes with washing buffer containing IX PBS/azide and 0.05% Tween-20, 
wells were blocked for 60 min at room temperature with 1 .0% bovine serum albumin in IX 
PBS/azide. Plates were washed five times and 50 /ul/well of serum or supernatant diluted in 
IX PBS/azide were added. Plates were incubated for 60 min at room temperature. The 
plates were washed five times and incubated at room temperature for a further 60 min in the 
presence of rabbit anti-species-specific immunoglobulin G linked to alkaline phosphatase 
(1 : 1000; 50 //1/well). Following another five washes, the substrate, p-nitrophenylphosphate 
(1 mg/ml; Sigma), in 0.16 M NaHC0 3 , 0.14 M NajCCv 0.02 M MgCl 2 , pH 9.6, was added 
at 50 //1/well to each well and incubated for 30 min at room temperature. Absorbance was 
read at 405 nm on a SLT-Lablnstruments EAR 400 AT. 

Immunization of Mice 

Three BALB/C mice were immunized subcutaneously in two groin sites (50 ul) and 
at two sites in the back (90 ul) with a 1:1 dilution of recombinant MAP2 (rMAP2; 50 
ug/mouse) and 2X Ribi monophosphoryl lipid A (MPL) and trehalose dicorynomycolate 
(TDM) adjuvant. Mice were boosted every two weeks after initial immunization as described 
during the primary immunization with an 1:1 emulsion of MAP2 and 2X Ribi MPL and 






67 
TDM's adjuvant. Mice were bled one week after each boost and the antibody titers of the 
sera were determined. 

Screening for Monoclonal Antibodies 

Spleen cells from Balb/C mice hyperimmunized with rMAP2 were fused with sp2/0 
myeloma cells (ATCC #CRL 1581) using the polyethylene glycol method and selected using 
the conventional hypoxanthine aminopterin-thymidine (HAT) selection techniques (Galfre and 
Milstein, 1981). Hybridoma supernates were screened in an indirect ELISA using rMAP2 
and anti-mouse IgG. Cells from antibody-positive wells were screened for competitive 
inhibition, and those showing inhibition with true positive (sheep #140) and no inhibition with 
the negative (Banks 014) or false positive (Rogers 060), were expanded, cryopreserved, 
cloned and re-cloned by limiting dilution. 

Supernatants from pure hybridomas were tested for effectiveness against rMAP2. 
Hybridoma clones secreting antibodies that demonstrated competition with true positive sera, 
but not false positive or true negative sera were selected. Monoclonal antibodies were 
purified, their isotypes were determined and they were concentrated for further studies. 

Competitive ELISA Development 

A cELISA using MAP2 was developed involving competition between unknown 
serum and the selected monoclonal antibody (MAb). The procedures were similar to the 
indirect ELISA method described above except after the initial washes, sample serum was 
added and incubated. Wells were washed (five times) and MAb added at the appropriate 



68 
dilution and incubated. An alternate method included a 60 min incubation of a mixture of 
MAb and sample sera after the initial washes. After washing, rabbit anti-mouse IgG linked 
with alkaline phosphatase (50 /ul/well; 1:1000) was added and incubated for one hour 
followed by the addition of substrate as described earlier. Absorbance was read at 405 nm.. 

Percent Inhibition 

Percent inhibition was calculated as follows: 



optical density of MAb alone - optical density of MAb versus competing sera x 100 
optical density of MAb alone 



Comparisons were made between the percent inhibition of true positive, false positive, and 
negative sera to determine whether any of the monoclonal antibodies were potential 
candidates for diagnostic development. 






69 



Table 9. Ovine and Bovine Sera Tested 





Species 


Animal # 


Isolate(s) Known 


Origin 


Positive Sera 


Ovine 


123 


Welgevonden/CS* 


VRL** 


Ovine 


127 


Welgevonden 


VRL 


Ovine 


136 


Welgevonden/CS 


VRL 


Ovine 


137 


Welgevonden/CS 


VRL 


Ovine 


139 


Welgevonden/CS 


VRL 


Ovine 


140 


Welgevonden/CS 


VRL 


Ovine 


88219 


Welgevonden/CS 


VRL 


Ovine 


369 


+*** 


VRL 


Ovine 


385 


-r 


VRL 


Ovine 


2310 


+ 


VRL 


Ovine 


378 


+ 


VRL 


Bovine 


8 


+ 


VRL 


Negative Sera 


Ovine 


012 


None**** 


Banks Farm 




Ovine 


014 


None 


Banks Farm 


Ovine 


015 


None 


Banks Farm 


Ovine 


181 


None 


VRL 


Ovine 


183 


None 


VRL 


Ovine 


188 


None 


VRL 


Ovine 


193 


None 


VRL 


Ovine 


134 


None 


VRL 


Bovine 


1 


None 


VRL 


Bovine 


2 


None 


VRL 


Bovine 


4 


None 


VRL 


Bovine 


5 


None 


VRL 


Bovine 


6 


None 


VRL 


False Positive 


Ovine 


056 


None 


Rogers Farm 




Ovine 


060 


None 


Rogers Farm 


Ovine 


062 


None 


Rogers Farm 


Ovine 


066 


None 


Rogers Farm 


Ovine 


2089 


None 


VRL 




Ovine 


7193 


None 


VRL 









70 



Table 9 (continued). 



False Positive 




Ovine 


2012 


None 


VRL 


Ovine 


2079 


None 


VRL 


Bovine 


132 


None 


VRL 


Bovine 


041 


None 


VRL 


Bovine 


004 


None 


VJU, 



*Crystal Springs isolate 

** Veterinary Research Laboratory, Causeway, Zimbabwe 
***Isolate unknown, animal positive for Cowdria ruminantium 
****Uninfected animal 



71 
Results 

Isolation and Characterization of Recombinant MAP2 

MAP2 (Figure 8) was eluted from anti-FLAG gel beads, dialyzed in IX PBS and 
analyzed using silver stain on a 12% SDS-PAGE gel. Recombinant MAP2 was shown to 
react with antibodies to C. ruminantium and thus maintained its antigenicity. 

Indirect ELISA for Heartwater Diagnosis Using MAP2 

The optimal concentration of rMAP2 was determined to be 4 ug/ml (Figure 9). 
Serum obtained from an animal experimentally infected with C. ruminantium (Sheep #140) 
tested positive at dilutions as low as 1 :3200 (Figure 10). Serum (Rogers 060) obtained from 
an animal from a heartwater- free region (false positive) reacted in a similar pattern to the true 
positive serum. Negative serum (Banks 014) consistently gave optical density values lower 
than the true positive and false positive sera at similar dilutions down to 1 : 12,800. 

Responses by Immunized Mice 

Sera from immunized mice were diluted two-fold beginning at the dilution 1:100. 
Immunized mice developed similar antibody titers to rMAP2 in an indirect ELISA (Figure 
11). Responses were at least two-fold the optical density of normal mice up to 1 :204,800 
titer for all three immunized mice. 









72 
Competitive Inhibition ELISA for Heartwater Diagnosis Using MAP2 

Subclones were developed from hybridoma clones which demonstrated competition 
with the true positive sera (Figures 12 and 13). Clone 1D5 was analyzed for competitive 
inhibition against positive sera [0.88 (mean) ± 0.04 (standard error)] versus competition 
against negative and true positive sera (1 .06 ± 0.04; grouped together). Clone 4D5 resulted 
in values of 0.56 ± 0.03 for competitive inhibition against positive sera versus 0.80 ± 0.03 
for competition against negative and true positive sera. Using the unpaired t-test of the 
analysis of variance, 1D5 and 4D5 were significant with P values of <.002 and <.0001, 
respectively. Two subclones were selected from each hybridoma clone and they were labeled 
HL945 and HL947 for hybridoma clone 1D5 and HL895 and HL896 for 4D5. These clones 
were tested in a competitive inhibition ELISA against true positive (OV2310 and OV385), 
false positive (OV2089 and OV2079), and negative (OV188 and OV134) sera. This 
competitive inhibition ELISA method contained a step whereby antisera were incubated for 
one hour before the monoclonal antibody was added. The results of the competitive inhibition 
are shown in Figure 14. Highest O.D.s were observed in CI-ELISAs with negative sera. 
True and false positive sera clearly inhibited both monoclonal antibodies. However, true and 
false positive sera were indistinguishable by this test. 









73 






69- 






46 - 



30- 



21.5- 



Figure 8. Major Antigenic Protein 2. MAP2 (arrow) was eluted from anti-FLAG gel beads, 
dialyzed in IX PBS and analyzed using silver stain on a 12% SDS-PAGE gel. 






K> 



A405 



OQ 



P 




n> 



iBf 



TO 



O.D. at 405 nm 










o 




-k 




hi 


o 


Ol 


-» 


en 


K) 


Ol 








1 


j^ 






N> - 














W - 














* - 






1 









> 3 



5"T3 2 

3 S 
Ea g. 



a 



o 

r-t- 

a. 



— (3* 

§ I 

3 

2 



a 
< 

6' 

c 

X o 
5 E 

ll 



o 

a 

09 -g 



_i 00 

II 



O CD 

o 













a 



A405 







B 



O.D. at405nm 




< 

CD 






CD 
(Q 
Q) 

<" 



o 
w 

< 




8 









ft 


T3 


*T1 


O 


(TQ 


9 

p 




o> 


k 


a> 




P 


g 


u> 


a 


i« 


■u 


T3 


O 




3T 


ES 

0> 


a* 
-i 


P 


§ 


a. 
o 




Cl 


jj 


ty> 


n 


p 


o 


01 


rn 


~c 




c 


o> 


n 


0) 

3 


t= 


* 


B 


!— 


o> 


§ 


_ 


o> 


.-+ 


CI 


03 


< 


O 


a. 


CD 


o 


D. 




k' 


(Li 

a. 


t/3 


o. 


•a 

3. 
O 


C/3 


t/) 


n> 


c 


•i 


n 




o 


*<3 




-1^ 


Ol 
>-l 


g 


a 


o> 


oi 


P 


* 


5 


c 


■-I 


a" 


ly> 


0> 


■-t 


o 


P 


o- 


v^ 


D- 


o 




a- 


i 


C/3 


<l> 


m 


0! 


!— 




"1 




i/j 


po 


P 


e 




3 


•n 


o 


a. 


n 


cr 


o 

C 
a- 


3 


p 


i 
g 


b 


P 


<— - 


t* 


O. 


> 


o 
3 




» 


> 


en 
■I 




O 


p 

en 


Oi 
Ol 

■a 


a* 


1- 

rro 


3 


<; 




o 


n 


"i 


3T 


Z 


p 
a* 


o> 


p 

on 


a" 



o 
ho 



O.D. at405nm 
o o o 
^ b> bo 



C/> 

a> 

o 
w 

I 



CD 
(Q 
0) 

<' 
CD 





9 m KU 

S 3 t3 




B-f-S 




S3^. 




ausly 

ouse 

405 






§ era 1 &* 




3 o n 




5" 5 




B* O* 




g> p 




&- en 





a 



o 



i 



ED 



O.D. at 405 nm 

o o 

b> oo 




3 £ 

G3 S 



■ ■■■■ 


CO 

3- 


o o o o o o 


0) 


<<<<<< 


CD 


■* M w .* ro M 


T3 


W O 00 00 o w 
& >4 Ol 00 00 ->• 




- 


(0 - - (DO 


CO 


z •. j z ■ : 

a n o 1 3 u 


(D 


CO TJ CO CO "DO 


■5 


CO 


fi> 



s 






80 
Discussion 

The MAP2 was determined to be conserved among the five geographic isolates of C. 
ruminantium (Chapter 3), therefore, it was important to determine whether sera obtained 
from both true positive and false positive animals would react with MAP2 of C. ruminantium. 
Data presented in this study confirmed the presence of a cross-reacting organism containing 
MAP2-like proteins. 

A monoclonal antibody specific for an unique epitope on MAP2 of the C. 
ruminantium appeared to be difficult to isolate as observed in the development of this 
competitive ELISA. Although the negative sera did not inhibit the binding of the antibodies 
to the antigen, both true positive and false positive sera inhibited the binding of monoclonal 
antibodies examined. 

Although the function of the MAP2 is not known, this protein is located on the 
surface of the organism and may be involved in adhesion, pathogenicity, or invasion, and 
therefore may be conserved among rickettsia. MSP5 of A. marginale, a closely related 
rickettsia, is similar to MAP2 (Visser et ah, 1992) and their identity is 55.5% at the nucleic 
acid level (Mahan et ah, 1994). In addition, examination of MAP2 (C. ruminantium) and 
MSP5 (A. marginale) at the amino acid level has shown identical stretches of six amino acids 
or more between A. marginale (Oklahoma strain) and the Crystal Springs isolate of C. 
ruminantium. Canine sera from Zimbabwe contained antibodies which were reactive with C. 
ruminantium and Ehrlichia canis in IFA tests (Matthewman et al., 1 994). More importantly, 
anti-recombinant MAP2 antiserum reacted with a MAP2 homolog of Ehrlichia canis 



81 
(Chapter 5). Because MAP2 or its homologs appear to be represented in several rickettsia, 
these proteins may have a similar function in the development of these organisms. Similar 
surface proteins between closely-related microorganisms have been reported earlier. For 
example, antibodies raised to a 60 kDa Babesia divergens merozoite protein reacted with a 
similar protein of the invasive stage of Plasmodium falciparum on immunoblots (Carey et 
al, 1994). This conservation among other rickettsia has been observed with MAPI of C. 
ruminantium which reacted with antisera to E. canis, Ehrlichia chaffeensis, Ehrlichia bovis 
(Jongejan et al., 1993) and sera obtained from white-tailed deer (Odocoileus virginianus) 
from southeastern U.S. (Katz et al, 1 996). Development of an immunoassay for heartwater 
may be dependent upon the discovery of a monoclonal antibody specific for an unique 
epitope on MAP2 because it appears that the whole protein is cross-reactive with antisera 
against Ehrlichieae. 

The examination of either truncated regions of MAP2, or monoclonal antibodies 
designed to epitopes shared among C. ruminantium isolates, but different in Ehrlichia spp., 
may be necessary in the development of an immunoassay for C. ruminantium. Examination 
of Ehrlichia spp. genomic DNA for sequences encoding MAP2 homologs will assist in the 
further development of an immunoassay for C. ruminantium diagnosis. 



CHAPTER 5 
ANALYSIS OF MAP2 HOMOLOGS OF EHRLICHIA CHAFFEENSIS 

AND EHRLICHIA CANIS 



Introduction 
Serological tests for cowdriosis have been found to lack specificity due to cross- 
reacting antibodies from animals suspected to be infected with closely related organisms of 
the genus Ehrlichia. Animals from regions free of both C ruminantium and heartwater 
vectors were shown to react with rMAP2 in immunoassays (Chapter 4). These cross- 
reactions may be due to the presence of Hyalomma and Rhipicephalus ticks that may transmit 
an Ehrlichia spp. to animals in these heartwater-free regions of Zimbabwe. In addition, 
studies on Ehrlichia spp. and C. ruminantium have shown a similarity in the ribosomal RNA 
(rRNA), a method used to elucidate phylogenetic relationships as well as for detection or 
identification of microorganisms (Woese, 1987). Two closely related ehrlichial species, E. 
canis and E. chaff eensis have been shown to be similar to C. ruminantium based on the 16S 
rRNA gene (van Vliet et al. , 1 992 ). In addition, antisera against various species of Ehrlichia 
reacted with or recognized several proteins of C. ruminantium including MAPI and MAP2 
in Western blots. Antisera to all Ehrlichia spp. examined (E. canis, E. ovina, and E. bovis) 
recognized MAPI; however, only E. canis and E. bovis antisera recognized the 21 kDa 
protein (Jongejan et al., 1 993). Although E. bovis may be a good organism to examine for 
the presence of a MAP2 homolog, it is not a good candidate for these studies because it has 

82 









83 
been established only recently in culture and is not as closely related to C. ruminantium as E. 

canis and E. chaffeensis. Therefore, E. canis and E. chaffeensis were examined for MAP2 
homologs because they have been successfully cultured and are more closely related to C. 
ruminantium. 

Ehrlichia canis is the etiologic agent of tropical canine pancytopenia or canine 
ehrlichiosis and is transmitted by the brown dog tick Rhipicephalus sanguineus (Groves et 
ah, 1975). This ubiquitous rickettsial organism (Donatien and Lestoquard, 1935) is common 
in Africa with a prevalence of 33% and 35% in dogs in Egypt and Zimbabwe, respectively 
(Matthewman et al. , 1 993). The disease is characterized by fever, depression, anorexia, and 
body weight loss in the acute phase. Clinically, the most overt sign of the disease is unilateral 
or bilateral epistaxis (Ewing, 1 969; Walker et al, 1 970) followed by death approximately one 
week later. Like most rickettsial diseases, tetracycline and its derivatives are the most 
effective clinical treatments (Amyx et al., 1 971 ). The most widely used method of diagnosing 
canine ehrlichiosis in the U.S. is the indirect fluorescent antibody assay which has been shown 
to be both sensitive and specific for use in dogs. Cowdria ruminantium antigens have been 
used to detect antibodies to E. canis by immunofluorescence (van Vliet et al., 1992) and 
western blots (Jongejan et al, 1993). 

Ehrlichia chaffeensis, a newly recognized member of the genus Ehrlichia, is the 
causative agent of human monocytic ehrlichiosis. Over 400 people from 30 states have been 
reported with the disease using both PCR and an IFA using cultured organisms (Dawson et 
al, 1996), and over 1500 people have been exposed to the organism using the IFA alone 
(Walker and Dumler, 1 996). The first case was reported in 1 987 from an army recruit at Fort 






84 
Chaffee, Arkansas (Maeda et al., 1987) and E. chaffeensis has been thus far identified in 
Amblyomma americanum using PCR amplification (Anderson et al., 1992). Approximately 
60% of E. chaffeensis-'mfected patients required hospitalization (Kelly et al, 1994). In 
addition to the U.S., cases have been reported in Europe and Africa (Morais et al., 1991; 
Uhaa et al., 1992). Confirmation of E. chaffeensis infection has been accomplished using 
indirect immunofluorescence using E. chaffeensis-infected DH82 cells as antigen (Dawson 
et al. , 1 99 1 ). Use of monoclonal antibody 1 A9 specific for E. chaffeensis in an immunoassay 
may improve diagnosis since it does not react with E. canis (Yu et al., 1993) which has a 
98.7% similarity at the rRNA level (van Vliet et al., 1992). With reference to possible 
diagnosis of C. ruminantium using MAP2, an E. chaffeensis 22 kDa protein has been 
observed with antisera to E. chaffeensis in Western blots (Chen et al. , 1 994; Rikihisa et al., 
1994; Chen etal, 1996). 

In order to determine whether MAP2 of C. ruminantium can be useful in heartwater 
diagnosis, MAP2 homo logs have been cloned from the genomic DNA of E. canis and E. 
chaffeensis. Primers were designed from sequences conserved between map! genes of C. 
ruminantium and the msp5 gene ofAnaplasma marginale. The availability of the sequences 
of MAP2 homologs from E. chaffeensis and E. canis may enable the development of C. 
ruminantium-specific diagnostic tests. This could be achieved using monoclonal antibodies 
against regions of MAP2 unique to C. ruminantium or synthetic peptides of unique regions 
as diagnostic antigens. 



85 
Materials and Methods 

Immunoblot of C. ruminantium and E. canis Antigens 

Cowdria ruminantium (A) or E. canis (B) lysates were separated by SDS-PAGE and 
transferred to nitrocellulose membranes. Membranes were blocked with Tris-buffered saline 
(TBS) (0.1 M Tris HC1, 0.9% NaCl [pH 8.0])-0.25% gelatin, then reacted with anti-C 
ruminantium antiserum (sheep 483; Crystal Springs isolate), anti-recombinant MAP2 
antiserum (sheep 1 77), or anti-£. canis antiserum (Mukanya dog, E. canis Oklahoma strain). 
Membranes were washed three times in TBS containing 0.25% Tween 20, reacted with 
peroxidase-labeled protein G (Zymed) for 2 hours, washed three times as described above, 
and developed by incubation with 4CN peroxidase substrate (Kirkegaard and Perry, 
Gaithersburg, MD). 

Origin of E. canis and E. chaff eensis 

Ehrlichia canis (Arkansas isolate) and E. chaffeensis (Oklahoma strain), were 
obtained from Jacqueline E. Dawson at the Centers for Disease Control and Prevention 
(Atlanta, GA) and cultured in canine macrophage cell line DH82 in minimum essential 
medium (Rikihisa et al., 1992), containing 10% fetal bovine serum and 2 mM L-glutamine 
in a 5% C0 2 -air atmosphere. Following lysis of host cells, cultured organisms were harvested 
and purified as in Chen et al. ( 1 996). The final pellet was resuspended in saline EDTA-(0. 1 5 
M NaCl, 0. 1 M Na^DTA) and used for extraction of genomic DNA by the SDS-proteinase 
K method (Reddy et al, 1996). 



86 



Amplification of the MAP2 Homo log Genes of E. canis and E. chaffeensis 

Primers (Table 10) were designed using information from one of three sources: 

1 . Sequences determined after alignment of conserved regions of the map2 gene 
of C. ruminantium and the msp5 gene of A. marginale (figure 15); 

2. Sequences obtained from newly sequenced regions of MAP2 homologs in E. 
canis or E. chaffeensis; and 

3. Primers developed to sequence the pF5.2 clone of the Crystal Springs isolate 
of C. ruminantium (Mahane? al., 1994). 

Primers were synthesized by either the Oligonucleotide Synthesis Laboratory (ICBR, 
University of Florida, Gainesville) or National Biosciences, Inc. (Plymouth, MN). Primers 
were used in various combinations (Table 1 1) to amplify MAP2 homologs of E. canis and 
E. chaffeensis. Briefly, polymerase chain reactions contained 200 mM Tris-HCl (pH 8.2), 
1 00 mM KC1, 60 mM (NH 4 ) 2 S0 4 , 20 mM MgCl 2 , 1 % Triton X- 1 00, 1 00 ^g/ml nuclease-free 
bovine serum albumin, 1 mM dNTPs, 0.5 /jM of each primer, 1 ng of DNA template, and 2.5 
units of Pfu DNA polymerase. Reactions were performed at 94 °C for 5 min, followed by 30 
cycles of varying denaturing, annealing and extension temperatures and times (Table 1 1). A 
final extension step at 72 °C was performed for 10 min in all reactions. Amplicons were 
analyzed by gel electrophoresis on a 0.8% agarose gel in 1 X TBE buffer (89 mM tris, 89 mM 
boric acid, 2 mM disodium EDTA). 



87 
Cloning 

Amplicons were concentrated to 20 ul in a Savant Speed Vac concentrator and ligated 
to EcoRV-digested pBluescript SK+ at 16°C in the presence of T4 DNA ligase at an 
insert:vector molar ratio of 8:1 . 

Escherichia coli XL1 -Blue cells were grown in L-broth containing tetracycline ( 12.5 
Hg/ml). Cells were centrifuged at 5000 rpm for 5 min at 4°C in a Jouan centrifuge, 
resuspended in 10 mM Tris-HCl (pH 7.6), 50 mM CaCl 2 and incubated on ice. Cells were 
centrifuged again at 5000 rpm under the same conditions and resuspended gently. The 
recombinant plasmid was used to transform competent E. coli XL 1 -blue cells and grown on 
LB agar plates in the presence of ampicillin (50 /-ig/ml), X-Gal (50 mg/ml) and IPTG (0.2 
mg/ml) (Sambrook et al, 1989). 

White colonies were picked from the plates, inoculated into terrific broth medium 
containing ampicillin, and incubated overnight at 37 °C with vigorous shaking. Plasmid DNA 
was extracted using the boiling prep method (Holmes and Quigley, 1981). At the end of the 
purification steps, plasmid DNA was resuspended in TE buffer (pH 8.0) containing 1 mg/ml 
DNase-free RNase and analyzed on a 0.8% agarose gel. 

DNA Sequencing and Sequence Data Analysis 

The DNA insert in pBluescript SK(+) was sequenced as double-stranded DNA using 
the dideoxy chain termination reactions using Sequenase (United States Biochemical), as 
recommended by the manufacturer. Briefly, DNA was denatured using 20 mM EDTA and 1 
N NaOH. The DNA was precipitated by incubation at -20 °C in the presence of 3 M sodium 



88 
acetate, pH 5.4 and 1 00% ethanol followed by centrifugation. The DNA was dried in a speed 
vac concentrator after a wash with 70% ethanol. 

In the presence of Sequenase reaction buffer (200 mM Tris-HCl, pH 7.5; 100 mM 
MgCl 2 ; 250 mM NaCl), the primer (10 ng//ul) was annealed to the DNA template by 
incubation at 37 °C. The annealed DNA was incubated with DTT (100 mM), labeling mix 
(0.3 uM dGTP, 0.3 uM dCTP, 0.3 uM dTTP), dATP[ 35 S], and Sequenase Version 2.0 at 
room temperature. The mixture was added to the appropriate dNTPs and incubated at 37°C. 
The reaction was stopped using stop solution (95% formamide; 20 mM EDTA; 0.05% 
bromophenol blue; 0.05% xylene cyanol FF) and the samples stored at -20 °C. 

The sequence gel was heated to 50 °C and the samples to 75 °C then loaded onto the 
gel. Short (1.5 hr) and long runs (2.5 hr) were done and the gel was removed from the 
electrophoresis apparatus, transferred onto 3M paper and dried in a gel vacuum dryer. The 
gel was exposed to Hyperfilm™ and the sequence was recorded from the film. T3 and T7 
plasmid-specific promoter primers were used in initial reactions and then new oligonucleotides 
were synthesized based on the sequences obtained ('primer walking'). Insert DNA was 
completely sequenced on both strands. 

Some PCR-amplified DNA was sequenced at the DNA Sequencing Core (ICBR, 
University of Florida, Gainesville) using primers developed by National Biosciences, 
Inc.(Plymouth, MN). 

The complete sequences were analyzed on the VAX system using the GCG programs 
package. Comparisons were made using the Map program for restriction enzyme analysis and 
the Pretty and Gap programs for comparisons between the difterent Ehrlichia species and 



89 
isolates of C ruminantium. All DNA sequences were translated into all six frames using the 
Map program of GCG. DNA sequences translating into open reading frames were selected 
and compared with the map2 gene of C. ruminantium isolates using the Pileup and Pretty 
programs of the GCG package. 

Southern Blot Analysis 

DNA probe labeling and probe hybridization was done according to instructions in the 
DIG/Genius™ System 1 kit. Briefly, amplified Ehrlichia DNA was incubated overnight at 
37 °C in IX hexanucleotide mix (6.25 A260 units/ml random hexanucleotides, 50 raM Tris- 
HC1, 10 mM MgCl 2 , 0.1 mM Dithioerythritol, and 0.2 mg/ml BSA; pH 7.2), IX dNTP 
labeling mix (0.1 mM dATP, 0.1 mM dCTP, 0.1 mM dGTP, 65 pM dTTP, 35 /uM DIG- 
dUTP; pH 6.5), and 2 units///l DNA polymerase I (Klenow enzyme, large fragment), labeling 
grade. Disodium EDTA (200 mM, pH 8.0) was added to the tube to terminate the reaction 
and glycogen solution (20 mg/ml) was added. The labeled DNA was precipitated with 0. 1 
volume of LiCl and 3 volumes of 100% ethanol (-20 °C) and incubated at -70 °C for 30 min. 
The solution was centrifuged at 13,000 x g for 15 min to pellet DNA, washed with 70% 
ethanol by centrifugation for 5 min, dried in a speed vac concentrator and resuspended in 50 
Ail of TE/SDS buffer. 

Gels containing target DNA were submerged in denaturing solution (0.5 N NaOH, 
1 .5 M NaCl) while shaking for 30 minutes at room temperature. Submerged gels were then 
neutralized in neutralization solution ( 1 .0 M Tris-HCl, pH 8.0; 1 .5 M NaCl) for 30 min. DNA 
was blotted overnight to a nylon membrane by capillary transfer to the membrane using 10X 



90 
SSC buffer ( 1 .5 M NaCl, 150 mM sodium citrate; pH 7.0). DNA was fixed to the membrane 
by UV fixation in the Stratalinker. The membrane was placed in a rolling bottle with 
prehybridization solution [5X SSC, 1.0% (w/v) Blocking reagent for nucleic acid 
hybridization, 0.1%N-lauroylsarcosine, 0.02% sodium dodecyl sulfate (SDS)] and incubated 
for two hours. The DNA probe was heated in a boiling water bath for 10 min to denature 
DNA, then diluted into the prehybridization solution and added to the membrane for 
overnight incubation. The membranes were washed three times with 2X SSC, 0.1% SDS for 
5 min at room temperature and three times with 0.5 X SSC, 0.1% SDS for 15 min at 50°C 
with heterologous DNA and 65 °C with homologous DNA. 

After washes, membranes were equilibrated in filtered Genius buffer 1 (100 mM Tris- 
HC1, 150 mM NaCl; pH 7.5) for 1 min, and blocked with Genius buffer 2 (2% Blocking 
reagent in Genius buffer 1) for 60 min. After Genius buffer 1 was discarded, the membrane 
was incubated for 30 min in antibody solution (anti-digoxigenin [Fab] conjugated to alkaline 
phosphatase; 1:10,000 in Genius buffer 2). The antibody solution was discarded and the 
membrane was washed three times for 1 5 minutes each with Genius buffer 1 . The membrane 
was equilibrated with Genius buffer 3 ( 1 00 mM Tris-HCl, 1 00 mM NaCl, 50 mM MgCl 2 ; pH 
9.5) and placed between two sheets of 3M transparency film. The top sheet was lifted and 
0.5 ml of diluted Lumigen PPD (1:100) was added to the membrane surface, excess liquid 
was removed and the covered membrane was exposed to Hyperfilm™ at room temperature. 



91 



Table 1 0. Primers Designed oi 
S4AP2 Homo logs of E. canis i 


Selected for Amplification of the Genes Encoding the 
ind E. chaffeensis 


Primers 


Nucleic acid sequence (5' to 3') 


AB281 


CTAATTTTATACAATGGAGC 


AB282 


GTSTTYATAACTRTTGATCC 


AB283 


TTCTATTTAATTAAGTATTAA 


AB284 


GARAAYCTMCCAAAYTCTTC 


AB346 


CCTGTTAACATTTGAATTCTTG 


AB347 


GCATTTGAATTCTAGGATC 


AB146 


CAGGGAAGCTTGCAATTTTTTTGGGATATTC 


F3 


GTTACATACCTATATTAATT 


F5 


CCTATAATGCAATATATTAAAC 


F9 


CAAATACATAAATAAAGAC 


F13 


GTAATTACTCATACACTAA 


F17 


GAGCACATCATGAAGGCTATC 


AB602 


GGTACATTATTGCAGAATGG 


AB603 


GATGATCTTTATCTGCTTGTCC 


AB604 


CCAAGTTGTGCAAGTGCTTCAG 


AB607 


TACNNAGNTNNNNCNNNCNNTNNA 


AB608 


TACNNAGNTNNNNCNNNCNNT 


AB620 


AAACTACTGAACAGGTAATT 


AB623 


CGTATTTGTTGTGCGCTGG 


AB624 


CGTATTTGCTGTGCATTTAC 



M 



A or C; N = A,C,G,T; R = A or G; S = G or C; Y = C or T 



92 



Am 1 gtatactcagttgcg 15 

III III 
Cr 1101 atagaaattttagattcacaatttgcatatttaaatactacaaagataaa 1150 

PRIMERS AB608 

Am 16 cctggcgcttgaccaacctgggca. . .taggtgctacgatcgcgcctgct 62 
I I I I III I I II I I 

Cr 1151 acatactataaaaatttttagtaacttgacataacacaacattgttatag 1200 
and AB607-» 

> ■ ■ ■ • 

Am 63 cgttttgccgtccggcaatgtggcgcatttttgagtgttcgttggggtgt 112 

I I I III I I I I I I III 
Cr 1201 catatatgatacgtgtttttataaaaaactctaattttatacaATGGAGC 1250 

PRIMER AB281~> 

• • • • • 

Am 113 gatagATGAGAATTTTCAAGATTGTGTCTAACCTTCTGCTGTTCGTTGCT 162 

I I I I I I I I I I I I I I I I I I I I | | | | 
Cr 1251 ACATCATGAAGGCTATCAAGTTTATACTTAATCTATGTTTACTATTTGCA 1300 

Am 163 GCCGTGTTCCTGGGGTACTCCTATGTGAACAAGAAAGGCAT.TTTCAGCA 211 

ii in 1 1 1 1 1 1 1 1 1 1 i i ii mi m ii ii i 

Cr 1301 GCAATTTTTTTGGGATATTCTTACATAACAAAACAAGGTATATTCCAACC 1350 

Am 212 AAATCGGCGAGAGGTTTACCACTTCCGAAGTTGTAAGTGAGGGCATAGCC 2 61 

Ml I M I II I I I I I I I I I I 
Cr 1351 AAAATTACACGACTCTCCTGATGTTAATATATCGAACAAAGCGGATATAA 1400 

Am 2 62 TCCGCGTCTTTCAACAATTTGGTTAATCACGAGGGGGTCACCGTCAGTAG 311 

I I I I I II I I I I I I I I I I I III I III 
Cr 1401 ATACTAGCTTT. . . . AGCTTAATTAATCAGGATGGTATTACGATATCTAG 1446 

Am 312 CGGCGATTTTGGCGGCAAGCACATGTTGGTAATATTCGGCTTCTCAGCCT 361 

I I I I I I I I I I I I I I I I I I I I I I I I I I II 
Cr 14 4 7 TAAAGACTTCCTTGGAAAACATATGTTAGTCCTTTTTGGGTTTTCTTCTT 14 96 

• • - . . 

Am 362 GTAAGTACACGTGCCCTACCGAGTTAGGCATGGCTTCTCAGCTCCTAAGT 411 

M I I I I I I I I I II MM I I I I I I I I I I 
Cr 14 97 GTAAAACTATTTGCCCCATGGAACTAGGGTTAGCATCCACAATTCTAGAT 154 6 

Am 412 AAACTAGGCGACCATGCCGATAAGTTGCAAGTTGTGTTCATAACTGTTGA 4 61 

MM M I M I I M II I I I I I I II II II I I I I | | MM 
Cr 1547 CAACTTGGCAACGAATCTGACAAGTTACAAGTAGTCTTTATAACTATTGA 1596 

PRIMER AB282-> 



Figure 15. Gap Program using the Major Surface Protein 5 of Anaplasma marginale vs. 
MAP2 of Cowdria ruminantium. Am represents the pAM104 clone containing the msp5 
gene of A. marginale and Cr represents the pF5.2 clone of the Crystal Springs isolate of 
C. ruminantium. The upper case letters represent the coding sequences of the msp5 and 
map2 genes. Asterisks (*) below the map2 gene and above the msp5 gene represent the 
termination codon. Bold letters represent the source of primer development. When both 
sequences are in bold letters, degenerate primers were developed (see Table 10). 



93 



Am 4 62 TCCGAAAAATGACACCGTAGCCAAGCTTAAAGAGTACCACAAGTCTTTTG 511 

I I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I Mill 
Cr 1597 TCCAACAAAAGATACTGTAGAAACACTAAAAGAGTTTCACAAAAATTTTG 164 6 

Am 512 ATGCGAGAATTCAGATGCTCACAGGCGAAGAAGCAGACATAAAGAGCGTG 561 

I I I I I I I I I I I I I I I I I I III I I I I I 

Cr 1647 ACTCACGGATTCAAATGTTAACAGGAAACATTGAAGCTATTAATCAAATA 1696 

Am 562 GTTGAAAACTACAAGGTGTATGTGGGCGACAAGAAGCCAAGTGATGGTGA 611 

II II I I I I I I I I I I I I I I II I I I I I I 

Cr 1697 GTACAAGGGTACAAAGTATATGTAGG . . . TCAGCCAGACAATGATAACCA 1743 

Am 612 TATCGACCACTCAACGTTCATGTACCTCATCAATGGGAAAGGCAGGTATG 661 

II I I I I I I I I II I I I I I I I I I I I III 
Cr 1744 AATTAACCATTCTGGAATAATGTATATTGTAGACAAGAAAGGAGAATATT 1793 

Am 662 TCGGGCATTTTGCGCCAGATTTTAACGCGTCTGAGGGCCAAGGCGAGGAG 711 

I I I I I I I I I I I I I I I I I I I III I I I I II I 

Cr 1794 TAACACATTTTGTACCAGATTTAAAGTCAAAAGAGCCTCAAGTGGATAAA 1843 

* 

Am 712 CTGTTTAAGTTTGTCA. . . GCGGTCACATGCTTAATTCTtagttaagcat 758 

I II II II II INN III! Mil 

Cr 1844 TTACTTTCTTTAATTAAGCAGTATCTTtaatTTAATACTTAATTAAATAG 1893 

* ^PRIMER AB283 

(Reverse and Complement) 

Am 759 ggcagtggtacagtttcgtgtgtcggtcgtccttgtgaggcagtagaaag 808 

III III I I I I I I I I II 
Cr 1894 AAtagtacagacttttatatagaatctaacctttaggatatatatctaat 1943 

Am 809 tatggggctttgggggctttcctttgtggcgtttgtcgcgcttgcgttag 858 

I I I I I I I I I I I I I I I I III II 
Cr 1944 gaagaagtttcttttagtcttatttttactgcttgtaatgttacccaaag 1993 

Am 859 gagctggggctgaccagatcagggtggttggctcttccaccgtgttccca 908 

II I I I I I I I I I I I I I I I I I I I I I I II I I I 
Cr 1994 attctaatgcggaacatatacatgttgttggatcatctacagcatttcca 2043 

Am 909 tttatctcttctgttgccGAAGAGTTTGGTAGATTCTCcgcctata. . . . 958 

II | | | | | I | | I I I I I I I I I I I I I I I I I I I I I I I I I 

Cr 2044 tttatcgcagcaatagcaGAAGAATTTGGGAGGTTTTCagattatg. . . . 2093 

^PRIMER AB284 

(Reverse and Complement) 



Figure 15 (continued). 












94 



Table 11. Primer Combinations and Optimal Temperatures for Amplification of the Genes 
encoding the MAP2 Homologs of Ehrlichia canis and Ehrlichia chaffeemis 


PRIMER COMBINATIONS 


DENATURING 


ANNEALING 


EXTENSION 


°C 


min 


°C 


min 


°C 


min 


AB281/AB283 


94 


1 


40 


1 


72 


1.5 


AB281/AB284 


94 


1 


40 


1 


72 


1.5 


AB282/AB283 


94 


1 


40 


1 


72 


1.5 


AB282/AB284 


94 


1 


40 


1 


72 


1.5 


AB346/F3 


94 


1.5 


37 


1.5 


72 


1.5 


AB346/F5 


94 


1.5 


37 


1.5 


72 


1.5 


AB346/F9 


94 


1.5 


37 


1.5 


72 


1.5 


AB346/F13 


94 


1.5 


37 


1.5 


72 


1.5 


AB346/F17 


94 


1.5 


37 


1.5 


72 


1.5 


AB346/AB146 


94 


1.5 


37 


1.5 


72 


1.5 


AB347/F3 


94 


1.5 


37 


1.5 


72 


1.5 


AB347/F5 


94 


1.5 


37 


1.5 


72 


1.5 


AB347/F9 


94 


1.5 


37 


1.5 


72 


1.5 


AB347/F13 


94 


1.5 


37 


1.5 


72 


1.5 


AB347/F17 


94 


1.5 


37 


1.5 


72 


1.5 


AB347/AB146 


94 


1.5 


37 


1.5 


72 


1.5 


AB602/AB608 


94 


1 


40 


1 


72 


1.5 


AB603/AB608 


94 


1 


40 


1 


72 


1.5 


AB604/AV608 


94 


1 


40 


1 


72 


1.5 


AB602/AB607 


94 


1 


40 


1 


72 


1.5 


AB603/AB607 


94 


1 


40 


1 


72 


1.5 


AB604/AB607 


94 


1 


40 


1 


72 


1.5 


AB620/AB623 


94 


1 


47 


1 


72 


1.5 


AB620/AB624 


94 


1 


47 


1 


72 


1.5 



95 



Results 






Immunoblot demonstrating antigenic similarity between C. ruminantium and E. canis 

Anti-C ruminantium antiserum from sheep 483 reacted with an 
approximately 21 kDa protein in both C. ruminantium and E. canis (figure 16). More 
specifically, antiserum raised against recombinant MAP2 (sheep 1 77) reacted with MAP2 
in C. ruminantium (A) and a MAP2 homolog in E. canis (B). Anti-£. canis antiserum 
(Mukanja) also reacted with an approximately 21 kDa protein in C. ruminantium and E. 
canis. 

Cloning and Sequence Analysis of the MAP2 Homologs of E. chaffeensis and E. canis 
PCR products were obtained using primer combinations AB282/AB284 with E. 
canis (figure 17) and E. chaffeensis genomic DNA (figure 18). The bands were 
approximately 0.5 kb and 2.0 kb for E. canis using AB282/AB284 and 0.5 kb for E. 
chaffeensis using AB282/AB284. DNA from the AB282/AB284 primer amplification 
was ligated into pBluescript and clones containing the inserted DNA of E. canis and E. 
chaffeensis were sequenced. The resulting sequences yielded 281 bases that were 
homologous with the 3' end of the map2 gene of C. ruminantium and 186 bases and 153 
bases 3' to the open reading frame of the MAP2 homologs of E. canis and E. chaffeensis, 
respectively. 



96 

A second set of complementary primers AB346 and AB347 were developed 
based on the 5' region of the newly sequenced E. canis and E. chaffeensis DNA, 
respectively, in order to amplify the 5' region of the DNA. Several primers developed for 
sequencing of the pF5.2 clone containing the map2 gene of the Crystal Spring isolate of C. 
ruminantium, were also used for amplifying the map2-like sequences of E. canis and E. 
chaffeensis. The resulting amplicons were analyzed by gel electrophoresis on a 0.8% 
agarose gel in IX TBE buffer. Some of the PCR products (figure 19) produced from 
amplification of £. canis using AB346/F17 and AB346/AB146 (lanes 5 and 6) and E. 
chaffeensis using AB347/AB146 (lane 12) hybridized with a digoxigenin- labeled map2 
probe (figure 20). Amplified DNA was ligated into pBluescript and clones containing the 
inserted DNA were sequenced. The resulting sequences and the AB282/AB284 
sequences for E. canis and E. chaffeensis were aligned and assembled using the Assemble 
program of the GCG package yielding 606 bases of the map2-\k& sequences of E. canis 
and 561 bases of the map2-]ike sequences of E. chaffeensis that were homologous to the 
map! gene of C. ruminantium. The sequences were analyzed for open reading frames 
using the MAP program of GCG and it was determined that both genes were missing their 
start codons suggesting that the 5' ends of the genes were still missing. 

Amplification of the map2-like gene of E. canis was achieved using degenerate 
primer AB608 (Table 10) developed based on regions conserved in the map2 gene of C. 
ruminantium and the msp5 gene of A. marginale (figure 15) and primer AB602 (Table 10) 
developed based on the 3' region of the map2-like gene of E. canis . The resulting 
amplicon was sequenced and used for the development of primers which would amplify 



97 
the entire map2-like gene. Final amplification of the entire map2-like genes of £. 
chaff eensis and E. canis was achieved (Figure 21) using 5' end primer AB620 and 3' end 
primers AB623 and AB624, respectively, which were developed based on the newly 
sequenced flanking regions of the map2- like genes. 






Sequence Analysis of the MAP2 Homo logs 

Clones of PCR products derived from AB620/AB624 and AB620/AB623 primer 
combinations were sequenced for E. canis (figure 22) and E. chaffeensis (figure 23), 
respectively. The sequences were compared with the reported sequences of the C. 
ruminantium isolates (Chapter 3) at both the nucleotide (figure 24) and amino acid (figure 
25) levels. After aligning the amino acid sequences, Ehrlichia spp. proteins begin four 
amino acids downstream from the starting methionine of MAP2 of C. ruminantium. A 
second methionine in the ORF of C. ruminantium at position 4 may represent the real start 
codon. Although MAP2 homologs in E. chaffeensis and E. canis were very homologous 
to C. ruminantium MAP2, they were distinguishable by numerous substitutions 
throughout the polypeptide chain. Although there is variability throughout the sequence, 
there is clearly not enough clustering to separate these into distinct conserved or variable 
regions as was observed with MAPI (Reddy et al., 1996). 

Percentage identities based on nucleotide and amino acid sequence data were 
calculated (Tables 12 and 13) for MAP2 of C. ruminantium, E. canis, and E. chaffeensis 
and MSP5 ofAnaplasma marginale. These data confirm the close taxonomic relationship 



98 
between C. ruminantium, E. canis, and E. chaffeensis suggested previously by sequence 
analysis of the 16S ribosomal RNA genes (van Vliet et ah, 1992). 









99 



Sheep 483 Sheep 177 

Pre Post Pre Post 

ABABAB AB 



Neg Mukanja 
A B A B 



200 

97.4 
69 

46 



30 



21.5 



14.3 




Figure 16. Immunoblot Demonstrating Antigenic Similarity Between Cowdria 
ruminantium and Ehrlichia canis. Lysates of C. ruminantium (A) or E. canis (B) were 
separated by SDS-PAGE and transferred to nitrocellulose membranes. Membranes were 
reacted with anti-C. ruminantium antiserum (sheep 483), anti-rMAP2 antiserum (sheep 

177) or antkE. canis antiserum (Mukanja). 



100 



M 



1 



3054- 

2036- 
1636- 



1018- 



506- 




Figure 17. Analysis of PCR products of Ehrlichia canis using primer AB282/AB284 (lane 
1). Two products observed at 500 bp and 2000 bp (arrows). M represents the 1 kb DNA 
ladder. 



101 



1 



3054- 

2036- 
1636- 



1018- 



506- 



Figure 18. Analysis of PCR products of Ehrlichia chaffeensis using primer AB282/AB284 
(lane 1). The predicted product was observed at approximately 500 bp (arrow). 






102 



1 2 3 4 5 6 7 8 9 10 11 12 



2036- 
1636- 

1018- 

517- 




Figure 19. Analysis of PCR products of Ehrlichia canis and Ehrlichia chaff eensis using 
various primer combinations. AB346/F3 (lane 1), AB346/F5 (lane 2), AB346/F9 (lane 3), 
AB346/F13 (lane 4), AB346/F17 (lane 5), AB346/AB146 (lane 6), AB347/F3 (lane 7), 
AB347/F5 (lane 8), AB347/F9 (lane 9), AB347/F13 (lane 10), AB347/F17 (lane 11), 
AB347/AB146(lane 12). 






103 



1 2 3 4 5 6 7 8 9 10 11 12 



2036- 
1636- 

1018- 

517- 




Figure 20. Southern blot analysis of PCR products of Ehrlichia canis and Ehrlichia 
chaffeensis using various primer combinations. AB347/AB146 (lane 1), AB347/F17 (lane 
2), AB347/F13 (lane 3), AB347/F9 (lane 4), AB347/F5 (lane 5), AB347/F3 (lane 6), 
AB346/AB146 (lane 7), AB346/F17 (lane 8), AB346/F13 (lane 9), AB346/F9 (lane 10), 
AB346/F5 (lane 11), AB346/F3(lane 12). 



104 



1 



3 4 5 6 



2036- 
1636- 



1018- 



517- 




Figure 21. Analysis of PCR products of Ehrlichia canis and Ehrlichia chaff eensis using 
various combinations. AB620/AB623 (lane 1 ), AB62 1/AB623 (lane 2), AB622/AB623 (lane 
3), AB620/AB624 (lane 4), AB621/AB624 (lane 5), AB622/AB624 (lane 6). Lanes 1-3 are 
products of E. chaff eensis and lanes 4-6 are products of E. canis. 



105 



1 acatgtatacattatagtaacaaatgttaccgtattttattcataagttaagtaaaatct 

61 ataccattctctttcactttatcagaagacttttatttatcacaaactcatgacgtatag 

121 tgtcacaaataaacacactgcaactgcaatcactacgtaaaactttaactcttctttttc 

181 acaactaaaatactaataaaagtaatataatataaaaaatcttaaataac TTGACA taat 

-35 

241 attactctaata TAGCAT atgtctagtatctctatactaaacatttatataatt GGAG ca 

-10 

301 tattaATGAAAGCTATCAAATTCATACTTAATGTCTGCTTACTATTTGCAGCAATATTTT 
MKAIKFILNVCLLFA-»AIFL 

361 TAGGGTATTCCTATATTACAAAACAAGGCATATTTCAAACAAAACATCATGATACACCTA 
GYSYITKQGI FQTKHHDTPN 

421 ATACTACTATACCAAATGAAGACGGTATTCAATCTAGCTTTAGCTTAATCAATCAAGACG 
TTIPNEDGIQSSFSLINQDG 

481 GTAAAACAGTAACCAGCCAAGATTTCCTAGGGAAACACATGTTAGTTTTGTTTGGATTCT 
KTVTSQDFLGKHMLVLFGFS 

541 CTGCATGTAAAAGCATTTGCCCTGCAGAATTGGGATTAGTATCTGAAGCACTTGCACAAC 
ACKSICPAELGLVSEALAQL 

601 TTGGTAATAATGCAGACAAATTACAAGTAATTTTTATTACAATTGATCCAAAAAATGATA 
GNNADKLQVIFITIDPKNDT 

661 CTGTAGAAAAATTAAAAGAATTTCATGAACATTTTGATTCAAGAATTCAAATGTTAACAG 
VEKLKEFHEHFDSRIQMLTG 

721 GAAATACTGAAGACATTAATCAAATAATTAAAAATTATAAAATATATGTTGGACAAGCAG 
NTEDINQIIKNYKIYVGQAD 

7 81 ATAAAGATCATCAAATTAACCATTCTGCAATAATGTACCTTATTGACAAAAAAGGATCAT 
KDHQINHSAIMYLIDKKGSY 

841 ATCTTTCACACTTCATTCCAGATTTAAAATCACAAGAAAATCAAGTAGATAAGTTACTAT 
LSHFIPDLKSQENQVDKLLS 

901 CTTTAGTTAAGCAGTATCTGTAAtttaataattaatt AAAG agaatagtacaca CTTT tt 
L V K Q Y L * 

961 ataaattcatggaatacgttggatgagtaggttttttttagtatttttagtgctaataac 
1021 attggcat 

Figure 22. Complete sequence of the MAP2 homolog of Ehrlichia canis. The arrow (-4) 
represents the predicted start of the mature protein. The asterisk (*) represents the stop 
codon. Underlined nucleotides 5' to the open reading frame with -35 and -10 below 
represent predicted promoter sequences. Double underlined nucleotides represent the 
predicted ribosomal binding site. Underlined nucleotides 3' to the open reading frame 
represent possible transcription termination sequences. 



106 



1 ggaaatctcatgtaaacgtgaaatactatattcttttttaaataccaatacaattgaata 

61 caaaaaaacttttacaacttattatgtttatcttaaaaccttattttaagattccttatg 

121 tcacaaaataacaaaaatactatttacaaaatacaccacaatttcatcaaataaaaaaaa 

181 ctatacactttattatactacagtagatataccataaaagattttaagtaac TTGACA ta 

-35 

241 atattaccttaata TAGCAT atgattcagtattttatattaaaatttattatgtatt GGA 

-10 

301 gcataaaATGAAAGTTATCAAATTTATACTTAATATCTGTTTATTATTTGCAGCAATTTT 
MKVIKFILNICLLFA">AIF 

361 TCTAGGATATTCCTACGTAACAAAACAAGGCATTTTTCAAGTAAGAGATCATAACACTCC 
LGYSYVTKQGI FQVRDHNTP 

421 CAATACAAATATATCAAATAAAGCCAGCATTACTACTAGTTTTTCGTTAGTAAATCAAGA 
NTNISNKASITTSFSLVNQD 

4 81 TGGAAATACAGTAAATAGTCAAGATTTTTTGGGAAAATACATGCTAGTTTTATTTGGATT 
GNTVNSQDFLGKYMLVLFGF 

541 TTCTTCATGTAAAAGCATCTGCCCTGCTGAATTAGGAATAGCATCTGAAGTTCTCTCACA 
SSCKSICPAELGIASEVLSQ 

601 GCTTGGTAATGACACAGACAAGTTACAAGTAATTTTCATTACAATTGATCCAACAAATGA 
LGNDTDKLQVIFITIDPTND 

661 TACTGTACAAAAATTAAAAACATTTCATGAACATTTTGATCCTAGAATTCAAATGCTAAC 
TVQKLKTFHEHFDPRIQMLT 

721 AGGCAGTGCAGAAGATATTGAAAAAATAAT AAAAAATTACAAAATATATGTTGGACAAGC 
GSAEDIEKIIKNYKIYVGQA 

781 AGATAAAGATAATCAAATTGATCACTCTGCCATAATGTACATTATCGATAAAAAAGGAGA 
DKDNQIDHSAIMYIIDKKGE 

841 ATACATTTCACACTTTTCTCCAGATTTAAAATCAACAGAAAATCAAGTAGATAAGTTACT 
YISHFSPDLKSTENQVDKLL 

901 ATCTATAATAAAACAATATCTCTAAtttaataattaatta AAGAG aatagtacaca CTCT 
SIIKQYL* 

961 Tatataaattcatggatatatgtgatgggtagatttcttttggtgtttctatcgctaatt 
1021 acatta 

Figure 23. Complete sequence of the MAP2 homolog of Ehrlichia chaffeensis. The arrow 
(-*) represents the predicted start of the mature protein. The asterisk (*) represents the 
stop codon. Underlined nucleotides 5' to the open reading frame with -35 and -10 below 
represent predicted promoter sequences. Double underlined nucleotides represent the 
predicted ribosomal binding site. Underlined nucleotides 3' to the open reading frame 
represent possible transcription termination sequences. 



107 



Highway ATGGAGCACA TCATGAAGGC TATCAAGTTT ATACTTAATC TATGTTTACT 

PalmRiver 

UmBanei 

Antigua 

Ecanis A A. .C G .C..C 

Echaff A.T A A .C T. 

51 
Highway ATTTGCAGCA ATTTTTTTGG GATATTCTTA CATAACAAAA CAAGGTATAT 

PalmRiver 

UmBanein 

Antigua 

Ecanis G A A. .G C.. T..T C.... 

Echaff C.A C .G C..T. 



Highway 

PalmRiver 

UmBanein 

Antigua 

Ecanis 

Echaff 



101 

TCCAACCAAA ATTACACGAC TCTCCTGATG TTAATATATC GAACAAAGCG 

. G 

. G T 

. G 

. . CAT ..T..T A.A...A..A C..C....C. A..TG...AC 
G . GAT . . TA . . A . . . . CA . . A CA A . . T C 



A. 

GT 



151 
Highway GATATAAATA CTAGCTTTAG CTTAATTAAT CAGGATGGTA TTACGATATC 

PalmRiver C 

UmBanein C 

Antigua C 

Ecanis .G...TC.AT C A..C.... AA. .AG. .A. 

Echaff AGC..T.C T...TC G...G.A A A. A...AG..AA 



Highway 

PalmRiver 

UmBanein 

Antigua 

Ecanis 

Echaff 



201 

TAGTAAAGAC TTCCTTGGAA AACATATGTT AGTCCTTTTT GGGTTTTCTT 



,CC. 
, .C. 



.1 
.1 



. . . .A. 
.TT.G. 



, . .C. 

.T.C. 



.TT.G. 
.TT.A. 



.A. 
.A. 



Highway 

PalmRiver 

UmBanein 

Antigua 

Ecanis 

Echaff 



251 

CTTGTAAAAC TATTTGCCCC ATGGAACTAG GGTTAGCATC CACAATTCTA 



.A. 
.A. 



.G C. 

.G C. 



,T GCA. 
,T GCT. 



.T.G. 

,T. . . 



.A. . . .T. . . 
.AA 



TGA.GCA. 
TGA.G. . . 



.T 

.C 



Figure 24. Comparison of the coding nucleotide sequences of MAP2 and MAP2 homologs 
of Isolates of Cowdria ruminantium and Ehrlichia species. The MAP2 coding sequences 
of the four isolates of C. ruminantium and the two species of Ehrlichia were determined 
for both strands and were aligned with the MAP2 sequence from the Highway isolate. The 
complete nucleotide sequence from the Highway isolate is presented. The sequences for 
other isolates and species are presented only when they differed from the Highway 
sequence. A dot indicates identity with the Highway sequence. 



301 



108 



Highway GATCAACTTG GCAACGAATC TGACAAGTTA CAAGTAGTCT TTATAACTAT 

PalmRiver G 

UmBanein G 

Antigua G . . . G 

Ecanis .CA T..TA.TG. A A A.T T..A.. 

Echaff TCA..G T..T..CA. A A.T. .C..T..A.. 



Highway 

PalmRiver 

UmBanein 

Antigua 

Ecanis 

Echaff 



351 

TGATCCAACA AAAGATACTG TAGAAACACT AAAAGAGTTT CACAAAAATT 



.A.T. 



• A. 



. TG. 



.A.T ACA TG..C. 



401 
Highway TTGACTCACG GATTCAAATG TTAACAGGAA ACATTGAAGC TATTAATCAA 

PalmRiver 

UmBanein 

Antigua 

Ecanis ....T...A. A T.C AC 

Echaff TC.TA. A C C. GTGCA A G.AA.. 

451 
Highway ATAGTACAAG GGTACAAAGT ATATGTAGGT CAGCCAGACA ATGATAACCA 

PalmRiver T A 

UmBanein T A 

Antigua T A 

Ecanis . . .A.TA. .A AT. .T. . .A T..A ..AG....T. .A...C.T.. 

Echaff ...A. .A. .A AT A T..A ..AG....T. .A T.. 

501 
Highway AATTAACCAT TCTGGAATAA TGTATATTGT AGACAAGAAA GGAGAATATT 

PalmRiver T 

UmBanein T 

Antigua T 

Ecanis C CC. .A. T A TC....C 

Echaff G.T..C CC C...A. C..T..A CA 

551 
Highway TAACACATTT TGTACCAGAT TTAAAGTCAA AAGAGCCTCA AGTGGATAAA 

PalmRiver ..G A 

UmBanein . . G A 

Antigua . .G A 

Ecanis .TT....C. CA.T A...C ....AAA A G 

Echaff .TT C. .TCT A C...AAA A G 



Highway 

PalmRiver 

UmBanein 

Antigua 

Ecanis 

Echaff 



601 

TTACTTTCTT TAATTAAGCA GTATCTT 



.A. 
.A. 



.A. .A. 



.G 
,C 



Figure 24 (continued). 



109 



Highway 

Palmrivr 

Umbanein 

Antigua 

Ecanis 

Echaff 



Highway 

Palmrivr 

Umbanein 

Antigua 

Ecanis 

Echaff 



Highway 

Palmrivr 

Umbanein 

Antigua 

Ecanis 

Echaff 



Highway 

Palmrivr 

Umbanein 

Antigua 

Ecanis 

Echaff 



1 50 

MEHIMKAIKF ILNLCLLFAA IFLGYSYITK QGIFQPKLHD SPDVNISNKA 



,V. 



, .V. 
NI. 



T.H. . T. NTT. P. ED 

.V VRD.N T.NT 



51 100 

DINTSFSLIN QDGITISSKD FLGKHMLVLF GFSSCKTICP MELGLASTIL 



G.QS. 
S.T. . 






...K.VT.Q A..S... A....V.EA. 

...N.VN.Q Y S... A...I..EV. 



101 150 

DQLGNESDKL QVVFITIDPT KDTVETLKEF HKNFDSRIQM LTGNIEAINQ 

A 

A 

AG 

A NA I KN....K EH T.D... 

S DT I N. . .QK.K.F HEH. .P SA.D.EK 

151 200 

IVQGYKVYVG QPDNDNQINH SGIMYIVDKK GEYLTHFVPD LKSKEPQVDK 

A 

A 

A 

.IKN..I... .A.K.H A. ..LI... .S..S..I Q.N 

.IKN..I... .A.K....D. .A. ...I IS..S T.N 



Highway 

Palmrivr 

Umbanein 

Antigua 

Ecanis 

Echaff 



201 
LLSLIKQYL J 



Figure 25. Comparison of the MAP2 and MAP2-like coding sequences at the amino acid 
level. The nucleotide sequences for four C. ruminantium isolates and two Ehrlichia 
species were translated. The complete sequence for the Highway isolate is presented. The 
sequences for other isolates and the Ehrlichia species are presented only when they 
differed from the Highway sequence. A dot indicates identity with the Highway 
sequences. 



110 



Table 12. Percent Identity of Nucleic Acid Sequences of MAP2 Homologs of Cowdria 
ruminantium, Ehrlichia canis, and Ehrlichia chaffeensis. 



Organism 


C. ruminantium 


E. canis 


E. chaffeensis 


A. marginale 


C. ruminantium 


100% 


76.53% 


74.11% 


55.26% 


E. canis 


- 


100% 


82.68% 


56.31% 


E. chaffeensis 


- 


- 


100% 


57.60% 


A. marginale 


- 


- 


- 


100% 









Ill 












Table 13. Percent (%) Identity of Amino Acid Sequences of MAP2 Homo logs of 
Cowdria ruminantium, Ehrlichia canis and Ehrlichia chaffeensis 



Organism 


C. ruminantium 


E. canis 


E. chaffeensis 


A. marginale 


C. ruminantium 


100% 


83.41% 


84.39% 


67.80% 


E. canis 


- 


100% 


87.31% 


69.75% 


E. chaffeensis 


- 


- 


100% 


69.26% 


A. marginale 


- 


- 


- 


100% 



112 
Discussion 

Antisera against recombinant MAP2 reacted with an E. canis protein that is 
approximately 21 kDa suggesting that there is a MAP2 homo log present in this species. In 
addition, anti-E. canis antiserum also recognized the MAP2 of C. ruminantium, showing that 
the MAP2 homologs have shared epitopes in these two closely related organisms. These 
results suggest that sera taken from animals infected with an Ehrlichiae other than C. 
ruminantium present in heartwater-endemic and heartwater-free regions could react with C. 
ruminantium proteins. Genes for the MAP2 homologs of E. chaffeensis and E. canis were 
cloned, sequenced, and compared with MAP2 of the Highway isolate of C. ruminantium and 
MSP5 of A. marginale. MAP2 (MSP5) homologs were present in all organisms examined. 
These homologs have a sequence variability between 12.69% to 30.74% in the predicted 
protein sequence (Table 14). In addition, the relative sequence variation between MAP2 
homologs from different species was similar to the relative sequence variation based on 16S 
ribosomal DNA (van Vliet et ah, 1992, Figure 35); therefore C. ruminantium was a closer 
relative of E. chaffeensis and E. canis than of A. marginale. This, along with the similarity 
between MAPI of C. ruminantium and the MAPI homologs of E. canis and E. chaffeensis 
(Reddy et ah, manuscript submitted) would support previous serological studies 
demonstrating that antibodies cross-reacted between organisms from the genera Cowdria and 
Ehrlichia (Jongejanef ah, 1989; 1993). 

Although similarities existed between MAP2 homologs of C. ruminantium, E. canis, 
and E. chaffeensis, numerous sequence differences were observed that spanned throughout 



113 
the protein coding sequence. The primary discrepancy between the MAP2 homo logs of C. 
ruminantium and the two Ehrlichia spp. appeared to be at the start methionine codon for C. 
ruminantium. The second methionine of C. ruminantium (four amino acids from the first 
methionine) was aligned with the first methionine of the Ehrlichia species suggesting that it 
was probably the true initiator methionine in MAP2. This was further supported by the 
alignment of MAP2 with MSP5 of A. marginale; MSP5 also begins at the second methionine 
of C. ruminanitum. There was a predicted ribosomal binding site 5' to the second methionine, 
but not 5' to the first methionine (Figure 26). Thus, the reported amino acid sequence of 
MAP2 (Mahan et ai, 1994) may be incorrect and should actually be shorter by four amino 
acids at the N-terminus. 

The MAP2 homo log of E. canis did not carry any predicted continuous antigenic 
determinants similar to MAP2 of C. ruminantium (Table 1 5) although its sequence at the 
amino acid level was 83.41% similar. The protein encoded 205 amino acids with a predicted 
molecular weight of 23,169 daltons. Using the Signal program of the PCGENE package, a 
signal peptide was predicted at the 5' end of the protein with a potential cleavage site between 
position 15 and 16 (Figure 22). This site was identical to the predicted cleavage site for 
mature MAP2 of C. ruminantium. Consensus promoter sequence motifs were identified as 
possible -35 (TTGACA) and -10 (TAGCAT) elements upstream from the start codon. Only 
the -10 element differed minimally from the element (TATAAT) of Escherichia coli (Figure 
22). A ribosomal binding site (GGAG) for mRNA of the MAP2 homo log was located 10 
bases upstream of the ATG and contains part of the Shine Dalgarno (AGGAGG) hexamer 



114 
(Figure 22). Possible transcription terminator sequences appear between nucleotides 93 8 and 

958. 

The MAP2 homolog of E. chaffeensis carried one predicted antigenic determinant 
(site 1, Table 15) similar to MAP2 of C. ruminantium. Like the MAP2 homolog of E. canis, 
the MAP2 homolog of £. chaffeensis encodes 205 amino acids with a predicted molecular 
weight of 23,142 daltons. A signal peptide was predicted at the 5' end of the protein with a 
potential cleavage site between position 15 and 16 (Figure 23). Promoters and ribosomal 
binding sites of the MAP2 homolog of £. chaffeensis were identical to the motifs described 
for E. canis (Figure 23). Potential transcription terminator sequences appeared between 
nucleotides 941 and 961. 

The presence of MAP2 homo logs in Ehrlichia species was confirmed by Western 
blot and isolation of the genes that encode these proteins. In addition, these results support 
the relationship with the major surface protein 5 (MSP5) of A. marginale, which has been 
shown to be a sensitive and specific diagnostic test for detecting the bovine anaplasmosis 
agent, A. marginale (Visser et al., 1992). The similarity between these proteins (MSP5, 
MAP2, and the MAP2 homo logs) demonstrated the conservation of this protein in at least 
these members of the alpha subdivison of the Order Rickettsiales. 

I believe that MAP2 is a strong immunoassay candidate because (1) the MAP2 is 
highly conserved among the different C. ruminantium isolates tested, (2) is recognized by 
anti-C. ruminantium infection sera from all sheep, goats, and cattle tested (Mahan et al., 
1994), (3) the MSP5 of A. marginale is a homolog of MAP2 and is shown to be a specific 
antigen for diagnosis of anaplasmosis, and (4) MAP2 homologs in two closely related 



115 
Ehrlichia species may be distinguished from C. ruminantium MAP2 due to numerous 
sequence differences throughout the polypeptide chain. However, the potential use of MAP2 
in diagnosis of either C. ruminantium or Ehrlichia spp. will require the development of 
truncated peptides or monoclonal antibodies specific to unique sequences of MAP2. 



116 

1 aaataatata gaaactacag cacaggtaat tagtaatctt atatcacaag cttgccaata 

61 tataacttcc gtaaaaaata tcaaaatatc agatccaact tgatatgata actatct... 

721 ...taacatt agtataaaaa aacatcaatg catattccag aaatctacta caaaatcaaa 

781 tacataaata aagacaatta aaacatatta tactaacata tataaataat aagctattta 

841 attaatttat aaataacgaa actcctctac agcattttta gaataatacc tactacacta 

901 ggaattattt acttgctata ttttatgcta gtcattgtaa taatacatat acaatagatt 

961 cataatcaac tctgaaatgt aattactcat acactaaaaa tatcattttt tatagcgtaa 

1021 gtatatacaa ttttactaca taactaaaag aaaaaacata gaagtttaaa ttttatttaa 

1081 ctaaacaata ctaaccaaaa tatagaaatt ttagattcac aatttgcata tttaaatact 

1141 acaaagataa aacatactat aaaaattttt agtaacttga cataacacaa cattgttata 

1201 gcatatatga tacgtgtttt tataaaaaac tctaatttta tacaat ggag cacatcATGA 

me h i M K 

1261 AGGCTATCAA GTTTATACTT AATCTATGTT TACTATTTGC AGCAATTTTT TTGGGATATT 

AIK FIL NLCL LFA A I F LGYS 

1321 CTTACATAAC AAAACAAGGT ATATTCCAAC CAAAATTACA CGACTCTCCT GATGTTAATA 

YIT KQG IFQP KLH DSP DVNI 

1381 TATCGAACAA AGCGGATATA AATACTAGCT TTAGCTTAAT TAATCAGGAT GGTATTACGA 

SNK ADI NTSF SLI NQD GITI 

14 41 TATCTAGTAA AGACTTCCTT GGAAAACATA TGTTAGTCCT TTTTGGGTTT TCTTCTTGTA 

SSK DFL GKHM LVL FGF SSCK 

1501 AAACTATTTG CCCCATGGAA CTAGGGTTAG CATCCACAAT TCTAGATCAA CTTGGCAACG 

TIC PME LGLA STI LDQ LGNE 

1561 AATCTGACAA GTTACAAGTA GTCTTTATAA CTATTGATCC AACAAAAGAT ACTGTAGAAA 

SDK LQV VFIT IDP TKD TVET 

1621 CACTAAAAGA GTTTCACAAA AATTTTGACT CACGGATTCA AATGTTAACA GGAAACATTG 

LKE FHK NFDS RIQ MLT GNIE 

1681 AAGCTATTAA TCAAATAGTA CAAGGGTACA AAGTATATGT AGGTCAGCCA GACAATGATA 

AIN QIV QGYK VYV GQP DNDN 

1741 ACCAAATTAA CCATTCTGGA ATAATGTATA TTGTAGACAA GAAAGGAGAA TATTTAACAC 

QIN HSG IMYI VDK KGE YLTH 

1801 ATTTTGTACC AGATTTAAAG TCAAAAGAGC CTCAAGTGGA TAAATTACTT TCTTTAATTA 

FVP DLK SKEP QVD KLL SLIK 

18 61 AGCAGTATCT TTAATTTAAT ACTTAATTAA ATAGAatagt acagactttt atatagaatc 

Q Y L * 
1921 taacctttag gatatatatc taatgaagaa gtttctttta gtcttatttt tactgcttgt 
1981 aatgttaccc aaagattcta atgcggaaca tatacatgtt gttggatcat ctacagcatt 
2041 tccatttatc gcagcaatag cagaagaatt tgggaggttt tcagattatg gaacacctat 
2101 aatagagtct gtggggagtg gtatgggttt tagtatgttt tgtcaaagtg tagaaaacag 
2161 tacgccagat atagctatgt catctcgtaa gataaaggat gcagaggtag aattatgtaa 
2221 aagtaatgac gttcatgaca ttattgaaat cattatagga tatgatggta ttgttattgc 
2281 aaactctaac aatagcaata agcttgattt tacaaaaaaa gatctattca aagctttaag 
2341 caagtatgca acgtcagaag aatatacaca tagtatacca gtaaatgatt ttaagtattg 
2401 gtcagaaatt aataataggt tccccaatat tgatattgaa gtttacggac catacaaaaa 
2461 cacaggtact tataatatac taatcgaaga aataatgcag gattcttgta tgaatcataa 
2521 aaatttcatt gaagtatacc cagacttaaa aaaaagacaa cacgcatgca gtatgatccg 
2581 caatgatggc aagtacattg aagttgcagc taatgaaaac attattatac aaaaaattgc 
2641 aaaaaataat gctgcttttg gtatttttag ttttagcttt ttaatacaga atcaagataa 
2701 aatacatgga aataaaattg caggtgtgga acctacatat gaaactattt cctctggaaa 
2761 atatatttta tea 

Figure 26. DNA sequence of pF5.2 plasmid insert DNA. The reported map2 gene and the 
revised amino acid sequence of MAP2 is shown in uppercase letters. Lowercased amino 
acids are part of the reported amino acid sequence of MAP2 by Mahan et al. (1994). The 
underlined area is the predicted ribosomal binding site. 






117 



Table 14. Percent (%) Identity of map2 Nucleic Acid 


Sequences/ 16S rDNA sequences 


Organism 




£ canis 


E. chaffeensis 


A. marginale 


C. ruminantium 


100/100 


76.53/96.8 


74.11/97.0 


55.26/92.1 


E. canis 


- 


100/100 


82.68/98.1 


56.31/91.9 


E. chaffeensis 


- 


- 


100/100 


57.60/91.8 


A. margin ale 


- 


- 


- 


100/100 



118 









Table 15. Prediction of Antigenic Determinants 





Highest Points of Hydrophilicity 


Organism 


1 


2 


3 


C. ruminantium 


Val-Asp-Lys-Lys-Gly-Glu 


Asp-Leu-Lys-Ser-Lys-Glu 


Gly-Asn-Glu-Ser-Asp-Lys 


E. canis 


Asp-Pro-Lys-Asn-Asp-Thr 


Val-Glu-Lys-Leu-Lys-Glu 


Gly-Gln-Ala-Asp-Lys-Asp 


E. chaffeensis 


lle-Asp-Lys-Lys-Gly-Glu 


Ala-Glu-Asp-lle-Glu-Lys 


Gin-Ala- As p-Lys-Asp-Asn-GIn 



'Calculations based on the method used by Hopp and Woods (1981). The average group 
length is 6 amino acids. 



CHAPTER 6 
CONCLUSIONS AND RECOMMENDATIONS 



Development of a sensitive and specific serodiagnostic test for Cowdria 
ruminantium is essential for epizootiological studies and control strategies. Presently, a 
serodiagnostic test has not been available that is completely reliable because of cross-reactions 
with unknown agents that have resulted in false positives. An immunoreactive 2 1 kDa protein 
(MAP2) was identified from C. ruminantium and the encoding gene was cloned and 
expressed in Escherichia coli. The recombinant MAP2 reacted with sera from C. 
ruminantium-'mfected sheep, goats, and cattle suggesting that it may be a good candidate for 
a diagnostic antigen. 

In this dissertation, I explore the potential use of MAP2 as an antigen for 
serodiagnosis of heartwater. Presently, there are over twenty isolates of C. ruminantium 
derived from sub-Saharan Africa and from the Caribbean. Five of these were selected in this 
study to determine whether MAP2 was conserved. The Crystal Springs, Palm River, and 
Highway isolates originated from Zimbabwe, where Amblyomma hebraeum, the South 
African bont tick is the vector. Another African isolate, Um Banein, originated from Sudan. 
The Caribbean isolate, Antigua, originated from Antigua in the British West Indies. 
Amblyomma variegatum, the tropical bont tick vectors Um Banein and Antigua isolates. 



119 



120 

The MAP2 was found to be a highly conserved protein among these five isolates of 
C. ruminantium (amino acid variability between 0% and 1.44%). In addition, the few 
sequence differences appeared to have little effect on the flexibility or predicted antigenic 
determinants of MAP2. Conservation of a protein is essential for the development of a 
sensitive assay. MAP2 was found to be conserved among the isolates examined even though 
they originated from various geographic regions and were transmitted by two separate 
vectors. 

After determining the conservation of this protein, the MAP2 was tested to 
determine whether it would react with known false positive sera similar to the MAPI protein. 
MAPI, the 32 kDa protein of C. ruminantium, was used previously as an antigen in a 
competitive enzyme-linked immunosorbent assay (ELIS A) ( Jongejan et al. , 1 99 1 ) . However, 
the MAPI was subsequently shown to be recognized by sera from sheep and cattle obtained 
from regions free of C. ruminantium and its vector (false positive reaction). 

This study also resulted in false positive serologic test reactions and reactivity 
between recombinant MAP2 and sera from heartwater-free animals was demonstrated. 
Attempted isolation of a monoclonal antibody specific for a unique epitope on MAP2 of C. 
ruminantium resulted in inhibition of monoclonal antibody binding by true and by false 
positive sera. Thus, like MAPI, MAP2 lacked specificity for a diagnostic test. Continued 
search for a monoclonal antibody specific for C. ruminantium may require extensive screening 
of monoclonal antibodies produced by different immunization regimes. In addition, a 
similarity between MAP2 of C. ruminantium and MSP5 of A. marginale confirms that this 
protein is at least partially conserved among rickettsial species. 



121 

Because MAP2 reacted with false positive sera, it was essential that we examine 
other rickettsia for the presence of MAP2 homologs to evaluate whether there was any basis 
for further screening of anti-MAP2 monoclonal antibodies or the use of specific MAP2 
regions for diagnosis. Possible cross-reacting agents in heartwater-free areas included E. 
ovina in sheep and E. bovis in cattle. In the Order Rickettsiales, C. ruminantium and several 
Ehrlichia sp. have been grouped in the alpha subdivison. These species include Ehrlichia 
canis, Ehrlichia chaffeensis, and A. marginale which have been determined to be closely 
related to C. ruminantium using ribosomal RNA studies. More importantly, E. canis and E. 
chaffeensis, were determined to be closer relatives of C. ruminantium than E. ovina and E. 
bovis. 

Ehrlichia canis and E. chaffeensis were selected for MAP2 homolog examination 
because: ( 1 ) it has not been proven that the cross-reacting organisms found in heartwater-free 
sheep and cattle are E. ovina and E. bovis; (2) isolation and comparison of MAP2 homologs 
from organisms (E. chaffeensis and E. canis) closely related to C. ruminantium may increase 
the chances of developing an assay specific for C. ruminantium; and (3) E. canis and E. 
chaffeensis can be cultured under in vitro conditions and are available for examination. 

MAP2 of C. ruminantium and a MAP2 homolog of E. canis were recognized by 
anti-C ruminantium and anti-£. canis antisera in immuno blots confirming the presence of a 
MAP2 homolog in an Ehrlichia species. The genes encoding MAP2 homologs for E. canis 
and E. chaffeensis were cloned, sequenced and open reading frames similar to the map2 gene 
were evaluated. The resulting MAP2 homologs had amino acid similarities of 83.41% for E. 
canis and 84.39% for E. chaffeensis with MAP2 of C ruminantium. 



122 

Like MSP5 of A. marginale, MAP2 may be useful in diagnosis of animals infected 
with C. ruminantium if a unique epitope(s) can be defined. MAP2 was found to be highly 
conserved among different geographic isolates of C. ruminantium and was recognized by sera 
from C. ruminantium-infected sheep, goats, and cattle. However, MAP2 reacted 
antigenically with anti-£. canis antiserum and MAP2 homologs were identified from E. canis 
and E. chaffeensis; thus, MAP2 as a whole protein lacks specificity for heartwater diagnosis. 
From this study, I conclude that the development of a serodiagnostic assay using MAP2 may 
require the use of truncated peptides or monoclonal antibodies specific to unique sequences 
of MAP2 of C. ruminantium. Further examination by developing smaller peptides and 
mapping epitopes in MAP2 responsive to anti-C ruminantium serum may result in the 
development of a specific serodiagnostic test. Further, the availability of the sequences of 
MAP2/MSP5 homologs in E. chaffeensis and E. canis may also aid in the development of 
specific diagnostic tests for these two species. A specific serodiagnostic test for human 
monocytic ehrlichiosis will be valuable in diagnosing this rapidly emerging human infectious 
disease. Cases of human ehrlichiosis including multi-organ system failure and death in HI VIE. 
chaffeensis-m&cted people are recently reported (Proceedings of 1 3 th Sesqui- Annual Meeting 
of the American Society for Rickettsiology, Champion, PA, September 21-24, 1997). 

The studies conducted herein have examined the use of MAP2 as a candidate 
antigen for use in a serodiagnostic test for heartwater. In doing so, the origin of serologic 
cross-reactions resulting in false positives was more clearly defined. Although MAP2 does 
not appear to be a good candidate antigen for a serodiagnostic test when used as the complete 






polypeptide, new strategies were developed that may lead to the identification of a test 
antigen based on monoclonal antibody development to unique antigenic sites of the MAP2. 









123 



124 
LIST OF REFERENCES 

Alexander, R.A. Heartwater: The Present State of Our Knowledge of the Disease. I7 h 

Report of the Director of Veterinary Services and Animal Husbandry 1:89-150 (1931). 

Ambrosio, R.E., Du Plessis, J.L., and Bezuidenhout, J.D. The Construction of Genomic 
Libraries of Cowdria ruminantium in An Expression Vector Agtll. Onderstepoort 
Journal of Veterinary Research 54:255-256 (1987). 

Amyx, H.L., Huxsoll, D.L., Zeiler, D.C., and Hildebrandt, P.K. Therapeutic and 
Prophylactic Value of Tetracycline in Dogs Infected with the Agent of Tropical Canine 
Pancytopenia. Journal of the American Veterinary Medical Association 159:1428-1432 
(1971). 

Anderson, B.E., Sumner, J.W., Dawson, J.E. et al. Detection of the Etiologic Agent of 
Human Ehrlichiosis by Polymerase Chain Reaction. Journal of Clinical Microbiology 
30:775-780 (1992). 

Andrew, H.R. and Norval, R.A.I. The Carrier Status of Sheep, Cattle, and African 
Buffalo Recovered from Heartwater. Veterinary Parasitology 34:261-266 (1989). 

Asselbergs, M., Jongejan, F., Langa, A., Neves, L., and Afonso, S. Antibodies to Cowdria 
ruminantium in Mozambican Goats and Cattle Detected by Immunofluorescence Using 
Endothelial Cell Culture Antigen. Tropical Animal Health and Production 25:144-150 
(1993). 

Audu, P.A., Agbede, R.I.S., and Esievo, K.A.N. Studies of Experimental Infection and 
Cross-Immunity Between Stocks of Cowdria ruminantium in Sokoto Red Goats. 

Veterinary Parasitology 59:23-28 (1995). 

Azad, A.F., Webb, L., Carl, M., and Dasch, G.A. Detection of Rickettsia in Arthropod 
Vectors by DNA Amplification Using the Polymerase Chain Reaction. Annals of the 
New York Academy of Sciences 590:557-563 (1990). 

Barnard, W.G. Heartwater Immunization Under Field Conditions in Swaziland. Bulletin 
of Epizootic Diseases in Africa 1 :30-3 10 (1953). 



125 

Barre, N., Uilenberg, G., Morel, P.C., and Camus, E. Danger oflntroducing Heartwater 
Onto the American Mainland: Potential Role of Indigeneous and Exotic Amblyomma 
Ticks. Onderstepoort Journal of Veterinary Research 54:405-417 (1987). 

Bezuidenhout, J.D. The Development of a New Heartwater Vaccine Using Amblyomma 
hebraeum Nymphae Infected with Cowdria ruminantium. In: Whitehead, G.B., and 
Gibson, J.D. (Editors): Tick Biology and Control. Tick Research Unit, Rhodes University, 
Grahamstown, p. 41 (1981). 

Bezuidenhout, J.D. The Present State of Cowdria ruminantium Cultivation in Cell Lines. 

Onderstepoort Journal Of Veterinary Research 54:205-210 (1987). 

Bezuidenhout, J.D. Natural Transmission of Heartwater. Onderstepoort Journal of 
Veterinary Research 54:349-351 (1987). 

Bezuidenhout, J.D. and Bigalke, R.D. The Control of Heartwater by Means of Tick 
Control. Onderstepoort Journal of Veterinary Research 54:525-528 (1987). 

Bezuidenhout, J.D., and Jacobz, C.J. Proof of Transovarial Transmission of Cowdria 
ruminantium by Amblyomma hebraeum. Onderstepoort Journal of Veterinary Research 
53:31-34(1986). 

Bezuidenhout, J.D. and Olivier, J.A. Identification of Additional Hosts and Vectors of 
Cowdria ruminantium. Biennial Report of Veterinary Research Institute Onderstepoort, 
Department of Agriculture and Water Supply , p 32. 

Bezuidenhout, J.D., Paterson, C.L., and Barnard, B.J.H. In vitro Cultivation of Cowdria 
ruminantium. Onderstepoort Journal Of Veterinary Research 52:113-120 (1985). 

Birnie, E.F., Burridge, M.J., Camus, and Barre, N. Heartwater in the Caribbean: Isolation 
of Cowdria ruminantium from Antigua. Veterinary Record 1 16:121-123 (1985). 

Bishopp, F.C., and Trembley, H.L. Distribution and Hosts of Certain North American 
Ticks. The Journal of Parasitology 31:1-54(1945). 

Burridge, M.J. Heartwater Invades the Caribbean. Parasitology Today 1:1-3 (1985). 

Burridge, M.J., Barre, N., Birnie, E.F., Camus, E., and Uilenberg, G. Epidemiological 
Studies on Heartwater in the Caribbean, with Observations on Tick- Associated Bovine 
Dermatophilosis. Proceedings of the 13th World Congress on Diseases of Cattle, Durban, 
Republic of South Africa, pp.542-546 (1984). 



126 

Byrom, B., and Yunker, C.E. Improved Culture Conditions for Cowdria ruminantium 
(Rickettsiales), the Agent of Heartwater Disease of Domestic Ruminants. Cytotechnology 
4:285-290(1990). 

Byrom, B., Yunker, C.E., Donovan, P.I., and Smith, G.E. In vitro Isolation of Cowdria 
ruminantium from Plasma of Infected Ruminants. Veterinary Research Communications 
26:263-268 (1991). 

Calder, J.A., Reddy, G.R., Chieves, L., Courtney, C.H., Littell, R., Livengood, J.R., Norval, 
R.A., Smith, C, and Dame,-J.B. Monitoring Babesia bovis Infections in Cattle by Using 
PCR-Based Tests. Journal of Clinical Microbiology 34: 2748-2755 (1996). 

Camus, E. and Barre, N. Epidemiology of Heartwater in Guadeloupe and in the 

Caribbean. Onderstepoort Journal of Veterinary Research 54:419-426 (1987). 

Camus, E., and Barre, N. Amblyomma variegatum and Associated Diseases in the 
Caribbean: Strategies for Control and Eradication in Guadeloupe. Parasitologia 
32:185-193(1990). 

Carey, B., Precigout, E., Valentin, A., Gorenflot, A., and Schrevel, J. A 37-Kilodalton 
Glycoprotein of Babesia divergens Is a Major Component of a Protective Fraction 
Containing Low-Molecular-Mass Culture-Derived Exoantigens. Infection and Immunity 
63:811-817(1995). 

Chen, S.M., Dumler, J.S., Feng, H.M, and Walker, D.H. Identification of the Antigenic 
Constituents of Ehrlichia chaffeensis. American Journal of Tropical Medicine and 
Hygiene 50:52-58 (1994). 

Chen, S.M., Popov, V.L., Feng, H.M, and Walker, D.H. Analysis and Ultrastructural 
Localization of Ehrlichia chaffeensis Proteins with Monoclonal Antibodies. American 
Journal of Tropical Medicine and Hygiene 54:405-412 (1996). 

Clifford, CM., Anastos, G., and Elbl, A. The Larval Ixodid Ticks of the Eastern United 
States (Acarina-Ixodidae). Miscellaneous Publications of the Entomological Society of 
America 2:215-237 (1961). 

Cline, M.J. (ed.) The White Cell. Second Edition. Harvard Press, Cambridge, Massachusetts. 

Colbo, M.H., and MacLeod, J. Ecological Studies of Ixodid Ticks (Acari, Ixodidae) in 
Zambia. II. Ticks Found on Small Mammals and Birds. Bulletin of Entomological 
Research 66:489-500 (1976). 



127 

Conlon, J.W., Clarke, I.W., and Ward, M.E. Epitope Mapping with Solid-Phase Peptides; 
Identification of Type-, Subspecies- and Genus-Reactive Antibody Binding Domains 
on the Major Outer Membrane Protein of Chlamydia trachomatis. Molecular 
Microbiology 2:673-679 (1988). 

Cooney, J.C., and Burgdorfer, W. Zoonotic Potential (Rocky Mountain Spotted Fever 
and Tularemia) in the Tennessee Valley Region. I. Ecologic Studies of Ticks Infesting 
Mammals in Land Between Lakes. American Journal of Tropical Medicine and Hygiene 
23:99-108(1974). 

Cooney, J.C. and Hays, K.L. Bionomics of the Gopher Tortoise Tick, Amblyomma 
tuberculatum Marx. Journal of Medical Entomology, 9: 239-245 (1972). 

Corn, J.L., Barre, N., Thiebot, B., Creekmore, T.E., Garris, G.I., and Nettles, V.F. Potential 
Role of Cattle Egrets, Bubulcus ibis (Ciconiformes: Ardeidae), in the Dissemination of 
Amblyomma variegatum (Acari: Ixodidae) in the Eastern Caribbean. Journal of Medical Entomology 
30:1029-1037(1993). 

Cowdry, E.V. Studies on the Etiology of Heartwater. I. Observation of Rickettsia, 
Rickettsia ruminantium (n.sp.) in the Tissues of Infected Animals. Journal of 
Experimental Medicine 42:231-252 (1925a). 

Cowdry, E.V. Studies on the Etiology of Heartwater. II. Observation of Rickettsia, 
Rickettsia ruminantium (n.sp.) in the Tissues of Ticks Transmitting The Disease. Journal 
of Experimental Medicine 42:231-252 (1925b). 

Cowdry, E.V. Cytological Studies on Heartwater. I. The Observation of Rickettsia 
ruminantium in the Tissues of Infected Animals. 11*- 12 th Report of the Director of 
Veterinary Research Un. South Africa, 161-177 (1926). 

Cowdry, E.V. Studies on the Etiology of Heartwater. III. The Multiplication of 
Rickettsia ruminantium within the Endothelial Cells of Infected Animals and Their 
Discharge into Circulation. Journal of Experimental Medicine 44:803-814 (1926). 

Curasson, G. Traite de Protozoologie Veterinaire et Comparee. Tome III. Paris. Vigot 
Freres, Paris (1943). 

Dame, J.B., Mahan, S.M., and Yowell, C.A. Phylogenetic Relationship of Cowdria 
ruminantium, Agent of Heartwater, to Anaplasma marginale and Other Members of the 
Order Rickettsiales Determined on the Basis of 16S rRNA Sequence. International 
Journal of Systemic Bacteriology 42:270-274 (1992). 



128 

Dardiri, A.H., Logan, L.L., and Mebus, C.A. Susceptibility of White-Tailed Deer to 
Experimental Heartwater Infections. Journal of Wildlife Diseases 23:215-219 (1987). 

Dawson, J.E., Anderson, B.E., Fishbein, D.B., et al. Isolation and Characterization of an 
Ehrlichia sp. From a Patient Diagnosed with Human Ehrlichiosis. Journal of Clinical 
Microbiology 29:2741-2745 (1991). 

Dawson, J.E., Warner, C.K., Standaert, S., and Olson, J.G. The Interface Between 
Research and the Diagnosis of an Emerging Tick-borne Disease, Human Ehrlichiosis 
Due to Ehrlichia chaffeensis. Archives on Internal Medicine 156:137-42 (1996). 

Deem, S.L., Norval, R.A., Donachie, P.L., and Mahan, S.M. Demonstration of Vertical 
Transmission of Cowdria ruminantium, the Causative Agent of Heartwater, from Cows 
to Their Calves. Veterinary Parasitology 6:119-132(1 996). 

Deem, S.L., Donachie, P.L., and Norval, R.A.I. Colostrum from Dams Living in a 
Heartwater-endemic Area Influences Calfhood Immunity to Cowdria ruminantium. 

Veterinary Parasitology 6:133-144 (1996). 

DeHaan, L.N., and F. Jongejan. Immunization Against Ticks with Special Reference to 
Amblyomma variegatum (Acarirlxodidae). Experimental and Applied Entomology, Neth. 
Entomological Society 1:1 13-120 (1990). 

Donatien, A., and Lestoquard, F. Existence en Algerie d'Une Rickettsia du Chien. Bulletin 
Soc. Pathol. Exot. 28:418-419 (1935). 

Doss, M.A., Farr, M.M., Roach, K.F., and Anastos, G. Catalogue of Medical and 
Veterinary Zoology, Special Publication No. 3. Ticks and Tickborne Diseases. 1. 
Genera and Species of Ticks, 1:48-51 (1974). 

Dower, K.M., Petney, T.N., and Horak, I.G. The Developmental Success of Amblyomma 
hebraeum and Amblyomma marmoreum on the Leopard Tortoise, Geochelone pardalis. 

Onderstepoort Journal of Veterinary Research 55:11-13 (1 988). 

Du Plessis, J.L. Pathogenesis of Heartwater: I. Cowdria ruminantium in the Lymph 
Nodes of Domestic Ruminants. Onderstepoort Journal of Veterinary Research 37:89-96 
(1970). 

Du Plessis, J.L., Boersema, B.R., and Van Strijp, M.F. The Detection of Antibodies Cross- 
Reacting with Cowdria ruminantium in the Sera of Domestic Ruminants in Regions of 
South Africa where Amblyomma hebraeum Does Not Occur. Onderstepoort Journal of 
Veterinary Research 61:277-281 (1994). 









Du Plessis, J.L., Camus, E., Oberem, P.T., and Malan, L. Heartwater Serology: Some 
Problems with the Interpretation of Results. Onderstepoort Journal of Veterinary 
Research 54:327-329 (1987a). 

Du Plessis, J.L., Loock, P. J., and Ludeman, C.J.F. Adult Amblyomma hebraeum Burdens 
and Heartwater Endemic Stability in Cattle. Onderstepoort Journal of Veterinary 
Research 59:75-89 (1992). 

Du Plessis, J.L. and Malan, L. The Application of the Indirect Fluorescent Antibody Test 

in Research on Heartwater. Onderstepoort Journal of Veterinary Research 54:319-325 
(1987a). 

Du Plessis, J.L. and Malan, L. The Non-Specific Resistance of Cattle to Heartwater. 

Onderstepoort Journal of Veterinary Research 54:333-336 (1987b). 

Du Plessis, J.L. and Malan, L. The Block Method of Vaccination Against Heartwater. 

Onderstepoort Journal of Veterinary Research 54:493-5 (1987c). 

Du Plessis, J.L. and Malan, L. Susceptibility to Heartwater of Calves Born to Non- 
Immune Cows. Onderstepoort Journal of Veterinary Research 55:235-237 (1988). 

Du Plessis, J.L., Malan, L., and Kowalski, Z.E. The Pathogenesis of Heartwater. 

Onderstepoort Journal of Veterinary Research 54:3 1 3-3 1 8 ( 1 987b). 

Du Plessis, J.L. , Van Gas, L., Olivier, J.A., and Bezuidenhout, J.D. The Heterogeneity of 
Cowdria ruminantium Stocks: Cross-Immunity and Serology in Sheep and 
Pathogenicity to Mice. Onderstepoort Journal of Veterinary Research 56:195-201 (1989). 

Durden, L.A., Luckhart, S., Mullen, G.R., and Smith, S. Tick Infestations of White-Tailed 
Deer in Alabama. Journal of Wildlife Diseases 27:606-614 (1991). 

Estrada-Pena, A., Castella, J., and Morel, P.C. Cuticular Hydrocarbon Composition, 
Phenotypic Variability, and Geographic Relationships in Allopatric Populations of 
Amblyomma variegatum (Acari:Ixodidae) from Africa and the Caribbean. Journal of 
Medical Entomology 31:534-544 (1994). 

Flach, E.J., Woodford, J.D., Morzaria, S.P., Dolan, T.T., and Shambwana, I. Identification 
of Babesia bovis and Cowdria ruminantium on the Island of Unguja, Zanzibar. 

Veterinary Record 126:57-59 (1990). 

Fivaz, B.H. Vaccination of Angora Goats Against Heartwater. Angora Journal, 
September (1990). 



130 

Galfre, G. and Milstein, C. Preparation of Monoclonal Antibodies: Strategies and 

Procedures. Methods in Enzymology 73:3-46 (1981). 

Groves, M.G., Dennis, G.L., Amyx, H.L. and Huxsoll, D.L. Transmission of Ehrlichia 
canis to Dogs by Ticks (Rhipicephalus sanguineus). American Journal of Veterinary 
Research 36:937-940 (1975). 

Hart, A., Kocan, K.A., Bezuidenhout, J.D., and Prozesky, L. Ultrastructural Morphology 
of Cowdria ruminantium in Midgut Epithelial Cells of Adult Amblyomma hebraeum 
Female Ticks. Onderstepoort Journal of Veterinary Research 58:187-183 (1991). 

Henning, M.W. Animal Diseases in South Africa. 3 rd Ed, South African Central News 
Agency Ltd, 17:410-417 (1957). 

Hopp, T.P. and Woods, K.R. A Computer Program for Predicting Protein Antigenic 
Determinants. Molecular Immunology 20:483-489 (1983). 

Ilemobade, A.A., and Blotkamp, C. Preliminary Observations on the Use of the Capillary 
Flocculation Test for the Diagnosis of Heartwater (Cowdria ruminantium Infection). 

Research in Veterinary Science 21:370-372 (1976). 

Ilemobade, A.A., and Blotkamp, C. Heartwater in Nigeria: II. The Isolation of Cowdria 
ruminantium from Live and dead Animals and the Importance of Routes of 
Inoculation. Tropical Animal Health and Production 10:39-44 (1978). 

Jackson, C. The Microscopic Diagnostics of Heartwater, A Preliminary Note on the 
Value of Intima Smears. 1 7th Report of the Director of Veterinary Services and Animal 
Industry of South Africa 1 : 1 6 1 - 1 73 ( 1 93 1 ). 

Jackson, C, and Neitz, W.O. On the Etiology of Heartwater, 18th Report of the Director 
of Veterinary Services and Animal Industry, Onderstepoort, Union of South Africa pp.49-70 
(1932). 

Jones, E.K., Clifford, CM., Keirans, J.E., and Kohls, G.M. The Ticks of Venezuela 
(Acarina: Ixodoidea) With a Key to the Species of Amblyomma in the Western 
Hemisphere. Brigham Young University Science Bulletin, 17:pages (1972). 

Jongejan, F. Protective Immunity to Heartwater (Cowdria ruminantium Infection) Is 
Acquired after Vaccination with In vitro- Attenuated Rickettsiae. Infection and Immunity 
59:729-731 (1991). 



131 

Jongejan, F. Experimental Transmission of Cowdria ruminantium (Rickettsiales) by the 
American Reptile Tick Amblyomma dissimile Koch, 1844. Experimental and Applied 
Acarology 15:117-121 (1992). 

Jongejan, F., de Vries, N., Nieuwenhuijs, J., van Vliet, A.H.M., and Wassink, L.A. The 
Immunodominant 32 kDa Protein of Cowdria ruminantium Is Conserved Within the 
Genus Ehrlichia. Revue d'Elevage etde Medecine Veterinaire desPays Tropicaux 46:145- 
152(1993). 

Jongejan, F., Morzaria, S.P., Shariff, O.A., and Abdalla, H.M. Isolation and Transmission 
of Cowdria ruminantium in Blue Nile Province, Sudan. Veterinary Research 
Communications 8:141-145 (1984). 

Jongejan, F. and Thielemans, M.J.C. Identification of an Immunodominant Antigenically 
Conserved 32-Kilodalton Protein from Cowdria ruminantium. Infection and Immunity 
57:3243-3246 (1989). 

Jongejan, F., Thielemans, M.J.C, De Groot, M., Van Kooten, P.J.S., and Van Der Zeijst, 
B.A.M. Competitive Enzyme-Linked Immunosorbent Assay for Heartwater Using 
Monoclonal Antibodies to a Cowdria ruminantium-Speciric 32-Kilodalton Protein. 

Veterinary Microbiology 28:1 99-2 1 1 ( 1 99 1 ). 

Jongejan, F., Uilenberg, G., and Franssen, F.F.J. Antigenic Differences Between Stocks of 
Cowdria ruminantium. Research in Veterinary Science 44:186-189 (1988). 

Jongejan, F., Vogel, S.W., Gueye, A., and Uilenberg, G. Vaccination against Heartwater 
Using In Vitro Attenuated Cowdria ruminantium Organisms. Revue d'Elevage et de 
Medecine Veterinaire des Pays Tropicaux 46:223-227 (1993). 

Jongejan, F., Wassink, L.A., Thielemans, M.J.C, Perie, N.M., and Uilenberg, G. Serotypes 
in Cowdria ruminantium and Their Relationship with Ehrlichia phagocytophila 
Determined by Immunofluorescence. Veterinary Microbiology 21 :31-40 (1989). 

Jongejan, F., Zandbergen, T.A., Van De Wiel, P. A., De Groot, M., and Uilenberg, G. The 
Tick-Borne Rickettsia Cowdria ruminantium Has a Chlamydia-hike Developmental 
Cycle. Onderstepoort Journal of Veterinary Research 58:227-237 (1991). 

Katz, J.B., Barbet, A.F., Mahan, S.M., Kumbula, D., Lockhart, J.M., Keel, M.K., Dawson, 
J.E., Olson, J.G., and Ewing, S.A. A Recombinant Antigen from the Heartwater Agent 
(Cowdria ruminantium) Reactive with Antibodies in Some Southeastern United States 
White-Tailed Deer (Odocoileus virginianus), but Not Cattle Sera. Journal of Wildlife 
Diseases 32:424-430 (1996). 



132 

Kelly, P.J., Matthewman, L.A., Mahan, S.M., Semu, S., Peter, T., Mason, P.R., Brouqui, P., 
and Raoult, D. Serological Evidence for Antigenic Relationships Between Ehrlichia canis 
and Cowdria ruminantium. Research in Veterinary Science 56:170-174 (1994). 

Knowles, D., Torioni de Echaide, S., Palmer, G., McGuire, T., Stiller, D., and McElwain, T. 
Antibody Against an Anaplasma marginale MSP5 Epitope Common to Tick and 
Erythrocyte Stages Identifies Persistently Infected Cattle. Journal of Clinical 
Microbiology 34:2225-2230 (1996). 

Kobold, A.M., Martinez, D., Camus, E., and Jongejan, F. Distribution of Heartwater in the 
Caribbean Determined on the Basis of Detection of Antibodies to the Conserved 32- 
Kilodalton Protein of Cowdria ruminantium. Journal of Clinical Microbiology 30:1 870- 
1873(1992). 

Kocan, K.M., and Bezuidenhout, J.D. Morphology and Development of Cowdria 
ruminantium in Amblyomma Ticks. Onderstepoort Journal ofVeterinary Research 54:177- 
182(1987). 

Kocan, K.M., Bezuidenhout, J.D., and Hart, A. Ultrastructural Features of Cowdria 
ruminantium in Midgut Epithelial Cells and Salivary Glands of Nympha\ Amblyomma 
hebraeum. Onderstepoort Journal of Veterinary Research 54:87-93 (1987). 

Kock, N.D., Van Vliet, A.H.M., Charlton, K., and Jongejan, F. Detection of Cowdria 
ruminantium in Blood and Bone marrow Samples from Clinically Normal, Free- 
Ranging Zimbabwean Wild Ungulates. Journal of Clinical Microbiology 33:2501-2504 
(1995). 

Lally, N.C., Nicoll, S., Paxton, E.A., Cary, CM., and Sumption, K.J. The Cowdria 
ruminantium groE Operon. Microbiology 141:2091-2100 (1995). 

Lawrence, J.A., Malika, J., Whiteland, A.P., and Kafuwa, P.T. Reactions to Heartwater 
Vaccination in Crossbred Zebu Cattle. Onderstepoort Journal of Veterinary Research 
62:19-23 (1995). 

Logan, L.L., Holland, C.J., Mebus, C.A, and Ristic, M. Serological Relationship Between 
Cowdria ruminantium and Certain Ehrlichia. Veterinary Record 1 19:458-459 (1986). 

Logan, L.L., Whyard, T.C., Quintereo, J.C., and C.A. Mebus. The Development of Cowdria 
ruminantium in Neutrophils. Onderstepoort Journal of Veterinary Research 54: 1 97-204 
(1987). 

Mackenzie, P.K.I., and Norval, R.A.I. The Transmission of Cowdria ruminantium by 
Amblyomma tholloni. Veterinary Parasitology 7:265-268 (1980). 






133 

Maeda, K., Markowitz, N., Hawley, R.C., Ristic, M., Cox, D., and McDade, J.E. Human 
Infection with Ehrlichia canis, a Leukocytic Rickettsia. New England Journal of Medicine 
316:853-856(1987). 

Mahan, S.M. Review of the Molecular Biology of Cowdria ruminantium. Veterinary 
Parasitology 57:51-56 (1995). 

Mahan, S.M., Andrew, H.R., Tebele, N., Burridge, M.J., and Barbet, A.F. Immunisation of 
Sheep Against Heartwater with Inactivated Cowdria ruminantium. Research in 
Veterinary Science 58:46-49 (1995). 

Mahan S.M., McGuire, T.C., Semu, S.M., Bowie, M.V., Jongejan, F., Ruangirwa, F.R. and 
Barbet, A.F. Molecular Cloning of a Gene Encoding the Immunogenic 21-Kilodalton 
Protein of Cowdria ruminantium. Microbiology 140:2135-2142 (1994). 

Mahan, S.M., Peter, T.F., Semu, S.M., Simbi, B.H., Norval, R.A.I., and Barbet, A.F. 
Laboratory Reared Amblyomma hebraeum and Amblyomma variegatum Ticks Differ 
in Their Susceptibility to Infection with Cowdria ruminantium. Epidemiol. Infect. 
115:345-353(1995). 

Mahan, S.M., Tebele, N., Mukwedeya, D., Semu, S., Nyathi, C.B., Wassink, L.A., Kelly, 
P.J., Peter, T., and Barbet, A.F. An Immunoblotting Diagnostic Assay for Heartwater 
Based on the I m inn nodominan I 32- Kiloda It on Protein of Cowdria ruminantium Detects 
False Positives in Field Sera. Journal of Clinical Microbiology 31:2729-2737 (1993). 

Mahan, S.M., Waghela, S.D., McGuire, T.C., Rurangirwa, F.R., Wassink, L.A., and Barbet, 
A.F. A Cloned DNA Probe for Cowdria ruminantium Hybridizes with Eight Heartwater 
Strains and Detects Infected Sheep. Journal of Clinical Microbiology 30:981-986 (1992). 

Mare, C.J. The Effect of Prolonged Oral Administration of Oxytetracycline on the 
Course of Heartwater (Cowdria ruminantium) Infection in Sheep. Tropical Animal 
Health and Production 4:69-73 (1972). 

Mare, C.J., Heartwater in Foreign Animal Diseases, Their Prevention, Diagnosis and 
Control. Committee of Foreign Animal Diseases(ed), U.S. Animal Health Assoc., Richmond, 
VA,pp 1186-1194 (1984). 

Martinez, D., Maillard, J.C., Coisne, S., Sheikboudou, C, and Bensaid, A. Protection of 
Goats Against Heartwater Acquired by Immunisation with Inactivated Elementary 
Bodies of Cowdria ruminantium. Veterinary Immunology and Immunopathology 41:153- 
163 (1994). 



134 

Matson, B.A., andNorval, R.A.I. Heartwater in Zimbabwe. Rhodesian Veterinary Journal 
8:2-6 (1977). 

Matthewman, L.A., Kelly, P.J., Bodade, P.A., Tagwira, M., Mason, P.R., Majok, A, 
Brouqui, P., and Raoult, D. Infections with Babesia canis and Ehrlichia canis in Dogs in 
Zimbabwe. Veterinary Record 133:344-346 (1993). 

Matthewman, L.A., Kelly, P.J., Mahan, S.M., Semu, S.M., Mason, P.R., Bruce, D., Brouqui, 
P. , and Raoult, D. Reactivity of Sera Collected from Dogs in Mutare, Zimbabwe, to 
Antigens of Ehrlichia canis and Cowdria ruminantium. Veterinary Record 134:498-499 
(1994). 

McGuire, T.C., Davis, W.C., Brassfield, A.L., McElwain, T.F., and Palmer, G.H. 
Identification ofAnaplasmamarginaleLong-term Carrier Cattle by Detection of Serum 
Antibody to Isolated MSP-3. Journal of Clinical Microbiology 29:788-793 (1991). 

McHardy, N., and MacKenzie, P.K.I. Virulence of Two Strains of Cowdria ruminantium 
in Mice and Their Use to Predict Drug Activity Against Heartwater. Tropical Animal 
Health and Production 16:56-62 (1984). 

Minshull, J. Seasonal Occurrence, Habitat Distribution, and Host Range of Four Ixodid 
Tick Species at Kyle Recreational Park in South Eastern Zimbabwe. Zimbabwe 
Veterinary Journal 12:58-63 (1981). 

Morais, J.D., Dawson, J.E., Greene, C, Filipe, A.R., Galhardas, L.C., and Bacellar, F. First 
European Case of Ehrlichiosis. Lancet 338:633-634 (1991). 

Muller Kobold, A., Martinez, D., Camus, E., and Jongejan, F. Distribution of Heartwater 
in the Caribbean Determined on the Basis of Detection of Antibodies to the Conserved 
32-KilodaIton Protein of Cowdria ruminantium. Journal of Clinical Microbiology 
30:1870-1873(1992). 

Mullis, KB., and Faloona, F.A. Specific Synthesis of DNA In vitro Via a Polymerase 
Catalyzed Chain Reaction. Methods in Enzymology 155:335-350 (1987). 

Musisi, F.L., and Hussein, N.A. Isolation, Transmission, and Some Serological Aspects 
of Cowdria ruminantium (Kafue strain). Rev. Sci. Techn. Off. Int. Epiz. 131-137 (1985). 

Neitz, A.W. and Vermeulen, N.M. Purification of Cowdria ruminantium By 
Immunoadsorbent Affinity Chromatography. Onderstepoort Journal of Veterinary 
Research 54:247-253(1987). 



135 

Neitz, A.W., Vermeulen, N.M., and Viljoen, G.J. Purification o( Cowdria ruminantium by 
Density Gradient Centrifugation. Onderstepoort Journal of Veterinary Research 54: 
223-231 (1987). 

Neitz, A.W., Viljoen, G.J., Bezuidenhout, J.D., Oberem, P.T., Putterill, J.F., Verschoor, J.A., 
Visser, L., and Vermeulen, N.M. Isolation oiCowdria ruminantium by Means of Percoll 
Density Gradient Centrifugation and Detection by an Enzyme-linked Immunosorbent 
Assay. Onderstepoort Journal of Veterinary Research 53:63-67 (1986). 

Neitz, W.O. Heartwater. Bulletin de L'Offwe International des Epizooties 70:329-336 
(1968). 

Neitz, W.O., and Alexander, R.A. The Immunization of Calves Against Heartwater. 

Journal of the South African Veterinary Medical Association 12:103-111 (1941). 

Neitz, W.O., and Alexander, R.A. Immunization Against Heartwater and the Control of 
Tick-Borne Diseases, Red water, Gall Sickness and Heartwater. Onderstepoort Journal 
of Veterinary Research 21:243-252 (1945). 

Neitz, W.O., Alexander, R.A., and Adelaar, T.F. Studies on Immunity in Heartwater. 

Onderstepoort Journal of Veterinary Science and Animal Industry 21 :243-252 (1947). 

Norval, R.A.I. The limiting effect of host availability for the immature stages on 
population growth in economically important ixodid ticks. Journal of Parasitology 65: 
285-287 (1979). 

Norval, R.A.I. The Ticks of Zimbabwe. VII. The Genus Amblyomma. Zimbabwe 
Veterinary Journal 14:3-18 (1983). 

Norval, R.A.I. The Impact of Pure Infestations of Rhipicephalus appendiculatus And 
Amblyomma hebraeum on The Productivity of Cattle And Implications For Tick 
Control Strategies in Africa. Parassitologia 32:155-63 (1990). 

Norval, R.A.I., Andrew, H.R., and Yunker, C.E. Pheromone-Mediation of Host-Selection 
in Bont Ticks (Amblyomma hebraeum Koch). Science 243:364-365 (1989). 

Norval, R.A.I., Andrew, H.R., and Yunker, C.E. Infection rates with Cowdria 
ruminantium of Nymphs and Adults of the Bont Ticks Amblyomma hebraeum Collected 
in the Field in Zimbabwe. Veterinary Parasitology 36:277-283 (1990). 

Norval, RAJ. and MacKenzie, P.K.I. The Transmission of Cowdria ruminantium by 
Amblyomma sparsum. Veterinary Parasitology 8:189-191 (1981). 



136 

Oberem, P.T., and Bezuidenhout, J.D. Heartwater in Hosts Other Than Domestic 
Ruminants. Onderstepoort Journal of Veterinary Research 54:271-275 (1987). 

Oberem, P.T., Bezuidenhout, J.D., Viljoen, G., Neitz, A.W.H., and Vermeulen, N.M.J. 
Attempts at the Purification of Cowdria ruminantium and the Development of 
Serological Techniques for Heartwater. Proceedings, XHIth World Congress on Diseases 
of Cattle, 531-535(1984). 

Okoh, A.E., Oyetunde, I.L., Ibu-Jo. Heartwater Infection (Cowdriosis) in a Sitatunga 
(Tragelaphus Spekei) in Nigeria. Journal of Wildlife Discovery 23:21 1-214 (1987). 

Palmer, G.H., Eid, G., Barbet, A.F., McGuire, T.C., and McElwain, T.F. The 
lmmunoprotective Anaplasma marginale Major Surface Protein 2 Is Encoded by A 
Polymorphic Multigene Family. Infection and Immunity 62:3808-16 (1994). 

Perreau, P.,Morel, P.C., Barre, B. and Durrand, P., Existence de la Cowdriose 
(Heartwater) a Cowdria ruminantium Chez les ruminants des Antilles Francaises (La 
Guadeloupe) et des Mascareignes (La Reunion et le Maurice). Revue d'Elevage et de 
Medicine Veterinaire des Pays Tropicaux 33:21-22 (1980). 

Peter, T.F., Deem, S.L., Barbet, A.F., NorvaL R.A., Simbi, B.H., Kelly, P.J., and Mahan, 
S.M. Development and Evaluation of PCR Assay for Detection of Low Levels of 
Cowdria ruminantium Infection in Amblyomma Ticks Not Detected by DNA Probe. 

Journal of Clinical Microbiology 33:166-72 (1995). 

Petney, T.N., Horak, I.G., and Rechav, Y. The Ecology of the African Vectors of 
Heartwater, with Particular Reference to Amblyomma hebraeum and Amblyomma 
variegatum. Onderstepoort Journal of Veterinary Research 54:381-395 (1987). 

Pienaar, J.G. Electron Microscopy of Cowdria (Rickettsia) ruminantium (Cowdry, 1926) 
in the Endothelial Cells of the Vertebrate Host. Onderstepoort Journal of Veterinary 
Research 37:67-78 (1970). 

Pienaar, J.G., Basson, P. A. and Van der Merwe, J.L. De B., Studies on the Pathology of 
Heartwater. I Neuro-Pathological Changes. Onderstepoort Journal of Veterinary 
Research 33:115-138 (1966). 

Pipano, E. Live Vaccines Against Hemoparasitic Diseases in Livestock. Veterinary 
Parasitology 57:213-31 (1995). 

Provost, A., and Bezuidenhout, J.D. The Historical Background and Global Importance 

of Heartwater. Onderstepoort Journal of Veterinary Research 54:165-169 (1987). 



137 

Prozesky, L. Diagnosis of Heartwater at Post-Mortem in Ruminants and the 
Confirmation of Cowdria ruminantium in Mice. Onderstepoort Journal of Veterinary 

Research 54:301-303. (1987). 

Prozesky, L. Heartwater. The Morphology of Cowdria ruminantium and Its Staining 
Characteristics in the Vertebrate Host and In Vitro. Onderstepoort Journal of Veterinary 
Research 54:173-176 (1987). 

Prozesky, L., Bezuidenhout, J.D., and Paterson, C.L. Heartwater. An In vitro Study of the 
Ultrastructure of Cowdria ruminantium. Onderstepoort Journal of Veterinary Research 
53:153-159(1986). 

Prozesky, L. and Du Plessis, J.L. The Pathology of Heartwater. I. A Study of Mice 
Infected With The Welgevonden Strain of Cowdria ruminantium. Onderstepoort Journal 
of Veterinary Research 52:71-79 (1985). 

Prozesky, L. and Du Plessis, J.L. Heartwater. The Development and Life Cycle of 
Cowdria ruminantium in the Vertebrate Host, Ticks and Cultured Endothelial Cells. 

Onderstepoort Journal of Veterinary Research 54:193-196 (1987). 

Purchase, H.S. A Simple and rapid Method for Demonstrating Rickettsia ruminantium 
(Cowdry 1925) in Heartwater Brains. Veterinary Record 57:413-414 (1945). 

Purnell, R.E., Gunter, T.D. and Schroder, J. Development of a Prophylactic Regime Using 
Long-acting Tetracycline for the Control of Redwater and Heartwater in Susceptible 
Cattle Moved into an Endemic Area. Tropical Animal Health and Production 21:11-19 
(1989). 

Rechav, Y., Parolis, H., Whitehead, G.B., and Knight, M.M. Evidence for An Assembly 
Pheromone Produced by Males of the Bont Tick, Amblyomma hebraeum (Acarina: 
Ixodidae). Journal of Medical Entomology 14:71-78 (1976). 

Rechav, Y., Whitehead, G.B., and Knight, M.M. Aggregation Response of Nymphs to 
Pheromone(s) Produced by Males of the Tick Amblyomma hebraeum Koch. Nature 
259:563-564 (1977). 

Reddy, G.R., Sulsona, C.R., Harrison, R.H., Mahan, S.M., Burridge, M.J., and Barbet, A.F. 
Sequence Heterogeneity of the Major Antigenic Protein 1 Genes from Cowdria 
ruminantium Isolates from Different Geographical Areas. Clinical and Diagnostic 
Laboratory Immunology 3:417-422 (1996). 

Rikihisa, Y. The Tribe Ehrlichieae and Ehrlichial Diseases. Clinical Microbiology 
Review 4:286-308 (1991). 



138 

Rikihisa, Y., Ewing, S.A., and Fox, J.C. Western Immunoblot Analysis of Ehrlichia 
chaffeensis, E. canis, or E. ewingii Infections in Dogs and Humans. Journal of Clinical 
Microbiology 32:2107-2112 (1994). 

Rikihisa, Y., Ewing, S.A., Fox, J.C, Siregar, A.G., Pasaribu, F.H., and Malole, M.B. 
Analysis of Ehrlichia canis and a Canine Granulocyte Ehrlichia Infection. Journal of 
Clinical Microbiology 29:2024-2029 (1992). 

Rossouw, M., Neitz, A.W.H., De Waal, D.T., Du Plessis, J.L., Van Gas, L., and Brett, S. 
Identification of the Antigenic Proteins of Cowdria ruminantium. Onderstepoort Journal 
of Veterinary Research 57:21 5-22 1 ( 1 990). 

Sahu, S.P. Fluorescent Antibody Technique to Detect Cowdria ruminantium in in vitro- 
Cultured Macrophages and Buffy Coats from Cattle, Sheep, and Goats. American 
Journal of Veterinary Research 47:1253-1257 (1986). 

Sambrook, J., Fritsch, E.F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 
Cold Spring Laboratory, Cold Spring Harbor, NY (1989), 

Samuel, W.M., and Trainer, D.O. Amblyomma (Acarina: Ixodidae) on White-Tailed Deer, 
Odocoileus virginianus, (Zimmerman) from South Texas with Implication for 
Theileriasis. Journal of Medical Entomology 1:561 -51 A (1970). 

Schreuder, B.E.C. A Simple Technique for the Collection of Brain Samples for the 
Diagnosis of Heartwater. Tropical Animal Health and Production 12:25-29 (1980). 

Scott, G.R. The Taxonomic Status of the Causative Agent of Heartwater. 

Onderstepoort Journal of Veterinary Research 54:257-260 (1987). 

Semu, S., Mahan, S.M., Yunker, C.E., and Burridge, M.J., Development and Persistence 
of Cowdria ruminantium Specific Antibodies following Experimental Infection of Cattle, 
as Detected by the IFA . Veterinary Immunology and Immunopathology 33:339-352 ( 1 992). 

Stewart, C.G. Specific Immunity in Farm Animals to Heartwater. Onderstepoort Journal 
of Veterinary Research 54:341-342 (1987). 

Strickland, R.K., Gerrish. R.R., and Smith, J.S. Arthropods In Diseases and Parasites of 
White-Tailed Deer, W. Davidson, F.A. Hayes, V.F. Nettles, and F.E. Kellogg (eds). 
Miscellaneous Publications No. 7 of Tall Timbers Research Station, Tallahassee, FL , pp. 
363-389(1981). 

Sutherst, R.W., and Maywald, G.F. A Computerized System for Matching Climates in 
Ecology. Agriculture, Ecosystems and Environment 13:281-299 (1985). 



139 

Sutton, G.D. Reactions to Heartwater Immunization Shown by Cattle. Journal of the 
South African Veterinary Medicine Association 31:285-288 (1960). 

Synge, B.A. Brain Biopsy for Diagnosis of Heartwater. Tropical Animal Health and 
Production 10:45-48 (1978). 

Uhaa, I.J., MacLean, J.D., Greene, C.R., Fishbein, D.B. A Case of Human Ehrlichiosis 
Acquired in Mali: Clinical and Laboratory Findings. American Journal of Tropical 
Medicine and Hygiene 46:161-164 (1992). 

Uilenberg, G. Experimental Transmission of Cowdria ruminantium by the Gulf Coast 
Tick Amblyomma maculatum: Danger of Introducing Heartwater and Benign African 
Theileriasis onto the American Mainland. American Journal of Veterinary Research 
43:1279-1282(1982). 

Uilenberg, G. Heartwater {Cowdria ruminantium Infection): Current Status. Advances 
in Veterinary Science and Comparative Medicine 27:427-480 (1983). 

Uilenberg, G. Extension de la Tique Amblyomma variegatum dans les Antilles Comment 
Expliquer Cette Grave Menace et Que Faire? Revue d'Elevage et de Medecine 
Veterinaire des Pays Tropicaux 43:297-299 (1990a). 

Uilenberg, G. Present and Future Possibilities for the Control of Cowdriosis and 
Anaplasmosis. Veterinary Quarterly 12:39-45 (1990b). 

Uilenberg, G., Barre, N., Camus, E., Burridge, M.J., and Garris, G.I. Heartwater in the 
Caribbean. Preventive Veterinary Medicine 2:255-267 (1984). 

Vande Pypekamp, H.E. andProzesky, L. Heartwater. An Overview of the Clinical Signs, 
Susceptibility, and Differential Diagnoses of the Disease in Domestic Ruminants. 

Onderstepoort Journal of Veterinary Research 54:263-266 (1987). 

Van der Merwe, L. Field Experience with Heartwater (Cowdria ruminantium) in Cattle. 

Journal of the South African Veterinary Association 50:323-325 (1979). 

Van der Merwe, L. The Infection and Treatment Method of Vaccination Against 
Heartwater. Onderstepoort Journal of Veterinary Research 54:489-491 (1987). 

van Vliet, A.H.M., Jongejan, F., and van der Zeijst, B.A.M. Phylogenetic Position of 
Cowdria ruminantium (Rickettsiales) Determined by Analysis of Amplified 16S 
Ribosomal DNA Sequences. International Journal of Systematic Bacteriology 42:494-498 
(1992). 



140 

van Vliet, A.H.M., Jongejan, F., van Kleef, M., and van der Zeijst, B.A.M. Molecular 
Cloning, Sequence Analysis, and Expression of the Gene Encoding the 
Immunodominant 32-Kilodalton Protein of Cowdria ruminantium. Infection and 
Immunity 62:1451-1456 (1994). 

Vermeulen, N.M., Neitz, A.W., and Viljoen, G.J. Purification of Cowdria ruminantium by 
Lectin Cellular Affinity Chromatography. Onderstepoort Journal of Veterinary Research 
54:233-246 (1987). 

Viljoen, G.J., Neitz, A.W., Bezuidenhout, J.D., Oberem, P.T. and Vermeulen, N.M. The 
Presence of Cowdria ruminantium Antigen in Various Tissues of Amblyomma hebraeum 
Images as Detected by an Enzyme-Linked Immunosorbent Assay. Onderstepoort Journal 
of Veterinary Research 55:239-240 (1988). 

Viljoen, G.J., Vermeulen, N.M., and Neitz, A.W. Theoretical Aspects of the 
Enzyme-linked Immunosorbent Assay Technique and its Use in the Detection of 
Cowdria ruminantium Antigen and Antibody in Reacting Animals. Onderstepoort 
Journal of Veterinary Research 54:305-12 (1987). 

Viljoen, G.J., Vermeulen, N.M., Oberem, P.T., Prozesky, L., Verschoor, J.A., Bezuidenhout, 
J.D., Putterill, J.F., Visser, L., and Neitz, A.W. Isolation of Cowdria ruminantium by 
Cellular Affinity Chromatography and Detection by an Enzyme- linked Immunosorbent 
Assay. Onderstepoort Journal of Veterinary Research 52:227-32 (1985). 

Visser, E.S., McGuire, T.C., Palmer, G.H., Davis, W.C., Shkap, V., Pipano, E. and Knowles, 
Jr., D.P. The Anaplasma marginale msp5 Gene Encodes a 19 Kilodalton Protein 
Conserved in All Recognized Anaplasma Species. Infection and Immunity 60:5139-5144 
(1992). 

Waghela, S.D., Rurangirwa, F.R., Mahan, S.m., Yunker, C.E., Crawford, T.B., Barbet, A.F., 
Burridge, M.J., McGuire, T.C. A Cloned DNA Probe Identifies Cowdria ruminantium in 
Amblyomma variegatum Ticks. Journal of Clinical Microbiology 29:2571-2577 (1991). 

Walker, D.H. and Dumler, J.S. Emergence of the Ehrlichioses as Human Health 
Problems. Emerging Infectious Diseases 2:18-29 (1996). 

Walker, J.B., and Olwage, A. The Tick Vectors of Cowdria ruminantium (Ixodoidea, 
Ixodidae, genus Amblyomma) and Their Distribution. Onderstepoort Journal of 
Veterinary Research 54:353-379 (1987). 

Wassink, L. A, Franssen, F.F. J., and Uilenberg, G. Observations on Mouse-Infective Stocks 
of Cowdria ruminantium: Attempts to Demonstrate Antigenic Changes of the 
Kwanyanga Stock in Mice. Research in Veterinary Science 41:98-101 (1986). 



141 

Wassink, L. A., Jongejan, F., Grays, E., and Uilenberg, G. Observations on Mouse-Infective 
Stocks of Cowdria ruminantium: Microscopical Demonstration of the Kwanyanga Stock 
in Mouse Tissue and the Carrier Status of the Senegal Stock in Mice. Research in 
Veterinary Science 48:389-390 (1990). 

White, F. The Vegetation of Africa. A Descriptive Memoir to Accompany the 
UNESCO/AETFAT/UNSO Vegetation Map of Africa. UNESCO, Paris (1983). 

Wilkins, S.C. and Ambrosio, R.E. The Isolation of Nucleic Acid Sequences Specific for 
Cowdria ruminantium. Onderstepoort Journal of Veterinary Research 56:1 27- 1 29 ( 1 989). 

Wilkins, S.C. and Ambrosio, R.E. A Differential Lysis Method for the Isolation of 
Cowdria ruminantium DNA. Veterinary Microbiology 25:39-44 (1990). 

Woese, C.R. Bacterial Evolution. Microbiology Review, 51:221-271 (1987). 

Yeoman, G.H. and Walker, J.B. The Ixodid Ticks of Tanzania. Commonwealth Institute 
of Entomology, London (1967). 

Yu, X., Brouqui, P., Dumler, J.S., and Raoult, D. Detection of Ehrlichia chaffeensis in 
Human Tissue by Using a Species-Specific Monoclonal Antibody. Journal of Clinical 
Microbiology 31:3284-3288 (1993). 

Yunker, C.E., Byrom, B., and Semu, S. Cultivation of Cowdria ruminantium in Bovine 
Vascular Endothelial Cells. Kenya Veterinarian 12:12-16 (1988). 

Yunker, C.E., Kocan, K.M., Norval, R.A.I, and Burridge, M.J. Distinctive Staining of 
Colonies of Cowdria ruminantium in Midguts of Amblyomma hebraeum. Onderstepoort 
Journal of Veterinary Research 54: 1 83- 1 85 ( 1 987). 

Yunker, C.E., Mahan, S.M., Waghela, S.D., McGuire, T.C., Rurangirwa, F.R., Barbet, A.F., 
and Wassink, L.A. Detection of Cowdria ruminantium by Means of a DNA probe, 
pCS20, in Infected Bont Ticks, Amblyomma hebraeum, the Major Vector of Heartwater 
in Southern Africa. Epidem. Infect. 110:95-104 (1993). 

Zwart, D. and Buys, J. Studies on Anaplasma ovis infection. II. Pathogenicity of a 
Nigerian goat strain for Dutch sheep and goats. Bulletin of Epizootic Diseases of Africa 
16:73-80(1968). 



142 
BIOGRAPHICAL SKETCH 

Michael Vernon Bowie was born on May 20, 1965 in Washington, D.C. Michael 
received the degree of Bachelor of Science in Biology in 1 987 from Morgan State University 
in Baltimore, Maryland. He continued his education for a master's degree in Veterinary 
Science in the College of Agriculture at The Pennsylvania State University. His master's 
thesis is entitled "The Effects of Fish Oil Diets on the Arachidonic Acid Production of Murine 
Kupffer Cells." Prior to completion of his master's degree, he was selected as an International 
Foundation for Education and Self-Help fellow and served as Assistant Veterinary 
Investigations Officer for the Ministry of Agriculture, Swaziland government, earning 
continuing education units from Tuskeegee University in Veterinary Medicine. Michael was 
responsible for tick identification, veterinary immunodiagnostics, and assistance with 
epidemiological studies including post mortem examinations. After returning to the United 
States, he graduated from The Pennsylvania State University in 1992 while pursuing a 
graduate degree in the Department of Pathobiology in the College of Veterinary Medicine at 
the University of Florida in Gainesville in which he began in the fall of 1991. He initially 
began his Ph.D. with Dr. R. A. I. Norval; however, after the sudden death of Dr. Norval in 
1994, he continued his dissertation in Professor Anthony F. Barbet's lab to determine the 
potential value of major antigenic protein 2 for serological diagnosis of heartwater disease. 
After graduation, Michael will remain at the University of Florida working on his post- 
doctorate under the University of Florida/United States Agency for International 
Development/Southern African Development Community's Heartwater Research Project. 



I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy. 



Anthony F. Barbet, Chair 
Professor of Veterinary Medicine 

I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy. 

Roman R GantaTCochair 
Assistant Scientist of Veterinary 
Medicine 

I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy. 

Mary B. Brown 

Associate Professor of Veterinary 
Medicine 

I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy. 

Donald J. Forrester 

Professor of Veterinary Medicine 






I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy. 

Kathy M. Kofcan 

Professor and Endowed Chair of 

Food Animal Research 
Oklahoma State University 



I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and quality, 
as a dissertation for the degree of Doctor of Philosophy. 





iCLitte! 
Professor of Statistics 



This dissertation submitted to the Graduate Faculty of the the College of 
Veterinary Medicine and to the Graduate School and was accepted as partial fulfillment of 
the requirements for the degree of Doctor of Philosophy. 

December 1997 



Dean, College of Veterinary 
Medicine 



Dean, Graduate School 















UNIVERSITY OF FLORIDA 



3 1262 08555 3187